We narrowed to 63,044 results for: cloning
-
Plasmid#18040DepositorInsertPaired (prd Fly)
ExpressionBacterialMutationPaired is simply used as an insert between Kpn1 a…Available sinceJune 20, 2008AvailabilityAcademic Institutions and Nonprofits only -
pENTR-PPP2R2B
Plasmid#16181DepositorPublicationInsertPP2A regulatory subunit B, beta isoform (PPP2R2B Human)
ExpressionMammalianAvailable sinceJan. 18, 2008AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP-N1-PARP1
Plasmid#211578PurposeCMV driven PARP1-eGFP expressing construct with IRES-Neomycin selectionDepositorAvailable sinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBAD-bARGSer-AxeTxe
Plasmid#192473PurposeSecond-generation bacterial acoustic reporter gene derived from SerratiaDepositorInsertsbARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterNative promoter from Enterococcus faecium and pBADAvailable sinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA C12 ecDHFR DD YFP HA
Plasmid#192815PurposeExpresses an N-terminal enhanced destabilizing domain (DD) version of E. coli DHFR with higher basal turnover in mammalian systems. Contains missense mutations W74R/T113S/E120D/Q146L.DepositorInsertE. coli dihydrofolate reductase
Tagsenhanced yellow fluorescent protein and hemagglut…ExpressionMammalianMutationW74R/T113S/E120D/Q146LPromoterCMVAvailable sinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
HIF-TRE-mStrawberry reporter
Plasmid#158681PurposeThis plasmid is a HIF1A pathway reporter. It has a 6 x HIF binding element promoter driving the expression of mStrawberry-pGK-BSDDepositorInsertmStrawberry
UseLentiviralExpressionMammalianAvailable sinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
RAR-TRE-mStrawberry reporter
Plasmid#158683PurposeThis plasmid is a RAR pathway reporter. It has a Retinoic Acid Receptor Response Element promoter driving the expression of mStrawberry-pGK-BSDDepositorInsertmStrawberry
UseLentiviralExpressionMammalianAvailable sinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pHN781
Plasmid#178828PurposeBacterial expression for human Saposin ADepositorInsertartificial gene encoding human Saposin A (AR Human)
TagsHis8, TEVExpressionBacterialMutationCodon-usage was optimized for bacterial expressio…PromoterT7Available sinceJan. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Frankenbody-FLAG-Halo
Plasmid#175296PurposeTrack mature and nascent FLAG tagged proteins in live cellsDepositorInsertanti-FLAG frankenbody fused with HaloTag
TagsHaloTagExpressionMammalianAvailable sinceOct. 7, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONRp5-p2 SspB-mCherry-CShroom3
Plasmid#170977PurposeC-terminal component of OptoShroom3 optogenetic tool. Translocates to apical junctions to induce constriction upon blue light illumination if coexpressed with GFP-NShroom3-iLID. pDONRp5-p2 plasmid.DepositorInsertCShroom3 (Shroom3 Mouse)
UseGateway CloningTagsSspB and mCherryMutationIsoform X2, deleted aminoacids 1 - 1388Available sinceJuly 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307-SARS-CoV-2-3CL
Plasmid#160278PurposeAllows for constituitive mammalian expression of the SARS-CoV-2 3CL protease via transfection or lentivirusDepositorInsert3CL Protease
UseLentiviralExpressionMammalianPromoterEF1aAvailable sinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLX301-ZIM3-KRAB-PYL1
Plasmid#154761PurposeExpresses ZIM3 KRAB domain fused to PYL1DepositorInsertZIM3 (ZIM3 Human)
UseLentiviralExpressionMammalianMutationIncludes ZIM3 aa 1-100PromoterCMVAvailable sinceOct. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
Sc++
Plasmid#155011PurposeExpresses the codon-optimized, engineered Sc++ Cas9 nuclease in mammalian cellsDepositorInsertSc++
ExpressionMammalianMutationT1227K, Loop Substitution from S. anginosusPromoterEF1ɑAvailable sinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AAV-EF1A-PSD95.FingR-eGFP-CCR5TC
Plasmid#125691PurposeGlobal labeling of excitatory synapses (green fluorescence)DepositorInsertPSD95.FingR-eGFP-CCR5TC
UseAAVExpressionMammalianPromoterEF1AAvailable sinceJuly 2, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA3.1-GGamma9-GFP2
Plasmid#140991PurposeEncodes a G gamma subunit (GNG9) containing GFP2 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorAvailable sinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
CIDAR MoClo Extension, Volume I
Plasmid kit#1000000161PurposePlasmids to efficiently build a wide variety of gene expression constructs. Can be used as a stand-alone toolkit or with the CIDAR MoClo Parts Kit (Addgene #1000000059).DepositorApplicationCloning and Synthetic BiologyVector typeBacterial ExpressionCloning typeGolden Gate (MoClo)Available sinceFeb. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNL(CMV)Luc2-Turbo RFP/CMV/WPREdU3
Plasmid#136959PurposeReporter vector encoding firefly luciferase and TurboRFP fluorescent proteinDepositorInsertFirefly luciferase and TurboRFP
UseLentiviralTagsV5 tagPromoterCMVAvailable sinceFeb. 7, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pTol1-UAS:ChrimsonR-tdTomato
Plasmid#124231PurposeZebrafish Tol1 construct for UAS-mediated expression of the optogenetic opsin ChrimsonR fused to the red fluorescent protein tdTomatoDepositorInsertChrimsonR-tdTomato
UseZebrafish expressionTagstdTomatoPromoter14xUAS-E1bAvailable sinceJan. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-H2B-iRFP720
Plasmid#128961PurposeLentiviral plasmid for expression of far red iRFP720 nuclear markerDepositorInsertHuman histone H2B (H2BC21 Human)
UseLentiviralTagsiRFP720ExpressionMammalianPromoterhPGKAvailable sinceAug. 2, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by