We narrowed to 7,002 results for: tac
-
Plasmid#127509PurposePlasmid has an EF1 alpha promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase 13 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase 13 attachment sites.
ExpressionMammalianAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pEF-GFP(rc)2
Plasmid#127504PurposePlasmid has an EF1 alpha promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase 2 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase 2 attachment sites.
ExpressionMammalianAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-CLASP2 512-650 9xS/A
Plasmid#24410DepositorInsertCLASP2 (512-650) 9xS/A (CLASP2 Human)
TagsEGFPExpressionMammalianMutationNonphosphorylatable CLASP2 deletion mutant that c…Available SinceApril 23, 2010AvailabilityAcademic Institutions and Nonprofits only -
pmCherryC1 VAP-A KD/MD
Plasmid#226408PurposeExpression of human VAP-A (mutant K94D/M96D, unable to bind FFAT motifs) fused to mCherry in mammalian cellsDepositorInsertVAP-A (VAPA Human)
TagsT7-Xpress tag and mCherryExpressionMammalianMutationK94D/M96D mutant, unable to bind FFAT motifsAvailable SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pC0043-PspCas13b-gRNA LINE1
Plasmid#223699PurposegRNA of dPspCas13b-FTO targeting LINE1DepositorInsertgRNA target sequence for LINE1
UseCRISPRExpressionMammalianAvailable SinceAug. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-SpCas9_gRNA(RHO-P23H)-CMV-mTagBFP2_(RAS3613)
Plasmid#228252PurposepU6 (human U6) expression of SpCas9 sgRNA targeting RHO P23H mutation and pCMV expression of mTagBFP2DepositorInsertSpCas9 P23H sgRNA, mTagBFP2
ExpressionMammalianMutationn/aPromoterCMV and U6Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 MLL2 653
Plasmid#11017DepositorInsertMLL2 (KMT2B Human)
TagsFLAGExpressionMammalianMutationtruncation of MLL2, last 653 amino acids, from pr…Available SinceJan. 5, 2006AvailabilityAcademic Institutions and Nonprofits only -
gRNA3_NIPBL_Cas9-hGem-for_N-terminal_tagging
Plasmid#217662Purposeexpresses Cas9-hGem and guideRNA for N terminal tagging of NIPBLDepositorInsertsgRNA3 for N terminal tagging of NIPBL (NIPBL Human)
UseCRISPRExpressionBacterial and MammalianPromoterU6Available SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cn-VA-NHEJ1-WT
Plasmid#141339PurposeLentiviral vector for expression of human NHEJ1-WT in mammalian cellsDepositorInsertNHEJ1 (NHEJ1 Human)
UseLentiviralTagsVA tag (3XFLAG-2XTEV-6XHis-2XStrep-Beacon)ExpressionMammalianPromoterCMVAvailable SinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
HNF4A_P2-285
Plasmid#31060DepositorInsertHNF4A P2 promoter (HNF4A Human)
UseLuciferaseExpressionMammalianMutation-285 to -1 of P2 HNF4A promoterAvailable SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
PA-mCherry-miniSOG-Mito-7
Plasmid#57795PurposeLocalization: Mitochondria, Excitation: 448 / 473, Emission: 500 / 528DepositorAvailable SinceFeb. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-Lyso-FLAG-GFP-Sac1-Cat-CS
Plasmid#134653Purposelysosome-targeted Sac1 catalytic domain C389SDepositorInsertSac1 catalytic domain (77-520 aa) CS mutant (SACM1L Human)
UseLentiviralTagsFLAG, GFP, and lysosomal-tag (p18 N-terminal 1-39…ExpressionMammalianMutationC389S and contains only amino acids 77-520 (Pleas…Available SinceDec. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLC-BFP-FADD
Plasmid#75166PurposeLentiCRISPR-BFP with sgRNA targeting human FADDDepositorAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 4 CMV GST mTagBFP
Plasmid#206259PurposeENTR Vector 4 for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes mTagBFP localised to Golgi organelles under the control of CMV promoter.DepositorInsertGTS mTagBFP
UseMultimate/gateway entr 4TagsBFGT1 (Golgi localisation peptide)ExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCR8/GW/TOPO-ELK4
Plasmid#98617PurposeGateway entry TOPO TA cloning vector for ELK4DepositorInsertELK4 (Elk4 Mouse)
UseTopo ta cloning vectorAvailable SinceJuly 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCR8/GW/TOPO-ETV1
Plasmid#98623PurposeGateway entry TOPO TA cloning vector for ETV1DepositorInsertETV1 (Etv1 Mouse)
UseTopo ta cloning vectorAvailable SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAD104_Asn152Ser_pCMV6Entry-hIRG1
Plasmid#124877PurposeExpresses hCAD Asp152Ser mutant in mammalian cellsDepositorInsertcis-aconitate decarboxylase (ACOD1 Human)
Tagsmyc and FLAG tagsExpressionMammalianMutationmutated Asn152 to SerPromoterCMVAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAD64_pCMV6_Entry_hIrg1
Plasmid#124879PurposeExpresses hCAD His103Ala mutant in mammalian cellsDepositorInsertcis-aconitate decarboxylase (ACOD1 Human)
Tagsmyc and FLAG tagsExpressionMammalianMutationmutated His103 to AlaPromoterCMVAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV 3xFLAG-ATG3 C264A
Plasmid#129297PurposeExpresses 3xFLAG-ATG3 C264A in mammalian cellsDepositorInsertUbiquitin-like-conjugating enzyme ATG3 (ATG3 Human)
Tags3xFLAGExpressionMammalianMutationchanged Cysteine 264 to AlaninePromoterCMVAvailable SinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only