We narrowed to 37,577 results for: ELL
-
Plasmid#101274PurposeGenetically encoded voltage indicator ASAP2s expressed under strong mammalian promoter (CAG)DepositorInsertASAP2s
ExpressionMammalianPromoterCAGAvailable sinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSR646
Plasmid#65215PurposeBaculovirus-mediated rAAV production: Expresses bicistronic AAV-2 rep gene and polycistronic AAV-6 cap gene in Sf9 insect cellsDepositorInsertsmodified AAV-2 rep78
modified AAV-6 cap
UseAAVExpressionInsectPromoterP10 and polyhedrinAvailable sinceMay 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
mTagRFP-T-Mito-7
Plasmid#58023PurposeLocalization: Mitochondria, Excitation: 555, Emission: 584DepositorAvailable sinceNov. 4, 2014AvailabilityIndustry, Academic Institutions, and NonprofitsCited by -
pKD237-3a-2
Plasmid#90957PurposeExpresses ThsR and mCherry constitutively and sfGFP under the PphsA promoterDepositorInsertsThiosulfate response regulator
Superfolder GFP
mCherry
ExpressionBacterialPromoterBba_J23100, Bba_J23105, and PphsAAvailable sinceMay 16, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
G protein alpha-q-GFP
Plasmid#66080PurposeThis G protein alpha-q construct contains internal insertions of GFP and the EE epitopeDepositorInsertG protein alpha-q-EE-YFP (Gnaq Mouse)
TagsGFP was inserted internally into the alpha-q sequ…ExpressionMammalianMutationBamHI and SacI sites in alpha-q were removed with…PromoterCMVAvailable sinceAug. 4, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA C12 ecDHFR DD YFP HA
Plasmid#192815PurposeExpresses an N-terminal enhanced destabilizing domain (DD) version of E. coli DHFR with higher basal turnover in mammalian systems. Contains missense mutations W74R/T113S/E120D/Q146L.DepositorInsertE. coli dihydrofolate reductase
Tagsenhanced yellow fluorescent protein and hemagglut…ExpressionMammalianMutationW74R/T113S/E120D/Q146LPromoterCMVAvailable sinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENTR221 UBR5
Plasmid#81062PurposeGateway entry vector encoding full length UBR5DepositorInsertUbiquitin protein ligase E3 component N-recognin 5 (UBR5) (UBR5 Human)
UseCloningMutationK503RPromoterN/AAvailable sinceJan. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pQE30-HyPer7
Plasmid#141071PurposeBacterial expression of ultrasensitive hydrogen peroxide indicator HyPer7 for optical imagingDepositorInsertHyPer7
TagsHisx6ExpressionBacterialPromoterT5Available sinceMarch 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-NlucP
Plasmid#162595PurposeC-terminally PEST-tagged NanoLuc under TRE3G promoterDepositorInsertNanoLuc-PEST
TagsPESTExpressionMammalianPromoterTRE3G promoterAvailable sinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
YFP-GID1
Plasmid#37305DepositorInsertSee comments
ExpressionMammalianAvailable sinceNov. 29, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSBtet-RN
Plasmid#60503PurposeSB-transposon with inducible SfiI cloning site for GOI (contains firefly luciferase) and constitutive expression of RFP, rtTA and neomycin resistance geneDepositorTypeEmpty backboneUseTransposonExpressionMammalianPromoterTCE & RPBSAAvailable sinceFeb. 11, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pYES-mtGFP
Plasmid#45053DepositorPublicationInsertmtGFP
ExpressionYeastPromoterGALAvailable sinceMay 24, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
NYESO alpha/beta into TRBC1 HDRT Source (pTR 262)
Plasmid#112022PurposeDNA sequence source for amplifying an HDR template to replace endogenous human TCR with 1G4 NYESO TCR at TCR-betaDepositorInsertNYESO alpha/beta into TRBC1 HDRDT
UseCRISPR and Synthetic BiologyAvailable sinceNov. 22, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP-ATXN1-52Q
Plasmid#32492DepositorPublicationInsertAtaxin-1 (ATXN1 Human)
TagsGFPExpressionMammalianMutationinsert contains a stretch of 52 Glutamines and no…PromoterCMVAvailable sinceJuly 22, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pECIA14
Plasmid#47051PurposeThis is a Gateway destination vector for secreted expression in Drosophila cell culture by CuSO4 induction. Inserts will be pentamerized and tagged with Alkaline phosphatase, FLAG and His tagsDepositorTypeEmpty backboneUseSecreted expression in drosophila cultureTagsAlkaline Phosphatase (human, placental), Flag, HR…ExpressionInsectPromoterMetallothionein (Copper-Inducible)Available sinceAug. 30, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Flag p21 T145D
Plasmid#16242DepositorAvailable sinceNov. 30, 2007AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pF CAG luc-EGFP-cre puro
Plasmid#67503PurposeConstitutive expression of a firefly luciferase-enhanced green fluorescent protein-cre recombinase fusion protein in mammalian cellsDepositorInsertluciferase-EGFP-cre
UseCre/Lox, Lentiviral, and Luciferase ; Fluorescent…ExpressionMammalianPromoterCAGAvailable sinceFeb. 17, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
VV229: GCaMP6f in fck
Plasmid#58514PurposeExpresses GCaMP6f under the a-CamKII promoterDepositorInsertGCaMP6f
UseLentiviralTagsC-terminal FCYENEV (ER export motif); this was no…ExpressionMammalianPromotera-CamKIIAvailable sinceNov. 5, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
TRE:mCherry-p2a- bReaChES
Plasmid#163037PurposeFLiCRE reporter gene for neuronal expressionDepositorInsertmCherry-p2a-bReaChES
UseAAVExpressionMammalianPromoterTREAvailable sinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by