We narrowed to 10,855 results for: kars;
-
Plasmid#147901PurposeMammalian Expression of HsNot1iso1-KGRQtoSYAA-shRNAresDepositorInsertHsNot1iso1-KGRQtoSYAA-shRNAres (CNOT1 Human)
UseTagsGFP (G4C mutation)ExpressionMammalianMutationNM_016284.4, K1426S, G1451Y, R1458A, Q1549APromoterAvailable sinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-Ef1A-Myc-POLB(PAMmut)
Plasmid#176150PurposeN-terminus Myc-tagged POLB containing a mutation in the PAM site used by POLB gRNA1 & a hygromycin resistance cassetteDepositorInsertPolB (POLB Human)
UseLentiviralTagsMYCExpressionMammalianMutationMutation in the PAM site used by POLB gRNA1PromoterEF1AAvailable sinceFeb. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-CMV-EGFP-PolB(K72A)-PAMmut-Hygro
Plasmid#176087PurposeEGFP fused to the N-terminus of POLB containing the mutation Lys72Ala, a mutation in the PAM site used by POLBKOg1 & a hygromycin resistance cassetteDepositorInsertPolB (POLB Human)
UseLentiviralTagsEGFPExpressionMammalianMutationMutation in Lys72 to Ala, and mutation in the PAM…PromoterCMVAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-XL1/BRCT1-Linker-eGFP
Plasmid#176084PurposeEGFP fused to the C-terminus of a XL1/BRCT1 domain & a hygromycin resistance cassetteDepositorInsertXL1/BRCT1 (XRCC1 Human)
UseLentiviralTagsEGFPExpressionMammalianMutationPromoterEF1AAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.TRE.mArid3a.IRES.dTomato.PGK.sfGFP.P2A.Tet3G
Plasmid#169318PurposeDoxycycline-inducible expression of murine Arid3a cDNA with dTomato as reporter fluorescent proteinDepositorInsertArid3a (Arid3a Mouse)
UseLentiviralTagsIRES-dTomatoExpressionMutationPromoterTREAvailable sinceSept. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.SFFV.KRAB-mArid3a.IRES.GFP
Plasmid#169306PurposeConstitutive overexpression of murine KRAB-Arid3a fusion protein with GFP as reporter fluorescent proteinDepositorInsertKRAB-Arid3a (Arid3a Mouse)
UseLentiviralTagsIRES-EGFPExpressionMutationPromoterSFFVAvailable sinceJuly 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.SFFV.VP64-mArid3a.IRES.GFP
Plasmid#169313PurposeConstitutive overexpression of murine VP64-Arid3a fusion protein with GFP as reporter fluorescent proteinDepositorInsertVP64-Arid3a (Arid3a Mouse)
UseLentiviralTagsExpressionMutationPromoterSFFVAvailable sinceJuly 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgAR10
Plasmid#167003PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorInsertAR Promoter sgRNA 10 (AR Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available sinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
Donor-CD55-NeoR
Plasmid#153551PurposeUsed as a donor vector for the targeted knock-in of a CD55 mutation. This plasmid carries a neomycin resistance gene cassetteDepositorInsertmutant CD55 (a 1415-bp fragment from intron 3, exon 4 and intron 4, with a 1-bp mutation in exon 4), divided into 5' and 3' arms
UseAAV and Cre/Lox; Donor plasmid/targeting vectorTagsN/AExpressionMutationa 1-bp mutation in exon 4PromoterNo promoterAvailable sinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
Donor-PIGA-NeoR
Plasmid#153549PurposeUsed as a donor vector for the targeted knock-in of a PIGA mutation. This plasmid carries a neomycin resistance gene cassetteDepositorInsertmutant PIGA (a 1,991-bp fragment from intron 5 and exon 6 with a 3-bp mutation in exon 6), divided into 5' and 3' arms
UseAAV and Cre/Lox; Donor plasmid/targeting vectorTagsN/AExpressionMutationa 3-bp mutation in exon 6PromoterNo promoterAvailable sinceDec. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorInsertgRNA targeting AAVS1 intron 1 (PPP1R12C Human)
UseCRISPRTagsExpressionMammalianMutationPromoterhU6Available sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-p35S-GFP(rc)5
Plasmid#127523PurposePlasmid has a CaMV 35S promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase 5 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase 5 attachment sites.
UseTagsExpressionPlantMutationPromoterAvailable sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-p35S-GFP(rc)7
Plasmid#127524PurposePlasmid has a CaMV 35S promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase 7 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase 7 attachment sites.
UseTagsExpressionPlantMutationPromoterAvailable sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-p35S-GFP(rc)9
Plasmid#127525PurposePlasmid has a CaMV 35S promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase 9 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase 9 attachment sites.
UseTagsExpressionPlantMutationPromoterAvailable sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pEF-GFP(rc)5
Plasmid#127506PurposePlasmid has an EF1 alpha promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase 5 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase 5 attachment sites.
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pEF-GFP(rc)7
Plasmid#127507PurposePlasmid has an EF1 alpha promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase 7 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase 7 attachment sites.
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pEF-GFP(rc)9
Plasmid#127508PurposePlasmid has an EF1 alpha promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase 9 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase 9 attachment sites.
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pEF-GFP(rc)13
Plasmid#127509PurposePlasmid has an EF1 alpha promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase 13 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase 13 attachment sites.
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pUB-HspINT7
Plasmid#127515PurposePlasmid encodes H. sapiens codon optimized Integrase 7.DepositorInsertIntegrase 7 coding sequence codon optimized for H. sapiens expression.
UseTagsExpressionMammalianMutationIn 2126 position an G mutated for an T changed th…PromoterAvailable sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-p35S-GFP(rc)2
Plasmid#127521PurposePlasmid has a CaMV 35S promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase 2 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase 2 attachment sites.
UseTagsExpressionPlantMutationPromoterAvailable sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pEF-GFP(rc)2
Plasmid#127504PurposePlasmid has an EF1 alpha promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase 2 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase 2 attachment sites.
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pEF-GFP(rc)4
Plasmid#127505PurposePlasmid has an EF1 alpha promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase 4 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase 4 attachment sites.
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-Pur-Lyn-AktAR2-D
Plasmid#125198PurposeSB-transposon plasmid for stable expression of unphosphorylatable "dead" version of lipid raft-targeted Lyn-AktAR2 variant of FRET-based AKT activity reporterDepositorInsertLyn-AktAR2-D
UseTransposonTagsLyn tag (GCIKSKRKD), mCerulean3 and cpVenus[E172]ExpressionMammalianMutationFoxO1 Thr-24 changed to Val rendering this inacti…PromoterEF1a/RPBSAAvailable sinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PTH2-L22V
Plasmid#116639PurposeLentiviral expression of PTH2 L22VDepositorInsertPTH2 (PTH2 Human)
UseLentiviralTagsExpressionMutationL22VPromoterAvailable sinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-TBC1D3B
Plasmid#116798PurposeLentiviral expression of TBC1D3BDepositorInsertTBC1D3B (TBC1D3B Human)
UseLentiviralTagsExpressionMutationWTPromoterAvailable sinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PTH2
Plasmid#116781PurposeLentiviral expression of PTH2DepositorInsertPTH2 (PTH2 Human)
UseLentiviralTagsExpressionMutationWTPromoterAvailable sinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-NOTCH2NL
Plasmid#116766PurposeLentiviral expression of NOTCH2NLDepositorInsertNOTCH2NL (NOTCH2NLA Human)
UseLentiviralTagsExpressionMutationWTPromoterAvailable sinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-TBC1D3B-R162Q
Plasmid#116694PurposeLentiviral expression of TBC1D3B R162QDepositorInsertTBC1D3B (TBC1D3B Human)
UseLentiviralTagsExpressionMutationR162QPromoterAvailable sinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-WDR12-Q93K
Plasmid#116706PurposeLentiviral expression of WDR12 Q93KDepositorInsertWDR12 (WDR12 Human)
UseLentiviralTagsExpressionMutationQ93KPromoterAvailable sinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-TBC1D3B-G164E
Plasmid#116692PurposeLentiviral expression of TBC1D3B G164EDepositorInsertTBC1D3B (TBC1D3B Human)
UseLentiviralTagsExpressionMutationG164EPromoterAvailable sinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only