We narrowed to 5,041 results for: U6...
-
Plasmid#74179Purposelentiviral vector expressing sgRNA targeting LacZDepositorInsertLacZ sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6 PromoterAvailable SinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3
Plasmid#209025PurposeLentiviral backbone for expressing U6 driven hybrid guide (hg)RNAs with BveI cloning sites and puromycin selection markerDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
iMAP-61
Plasmid#187460PurposegRNA array of iMAP-61DepositorInsertsgRNA array
UsePiggybacExpressionMammalianPromotermodified U6Available SinceOct. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJZC48
Plasmid#62336PurposesgRNA + 1x COM with COM-VP64 effector for mammalian cellsDepositorInsertssgRNA + 1x COM binding module
COM-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ITR-EcYtR(NGS-6)-mCherry
Plasmid#217363PurposeExpresses E. coli tyrosine tRNA variant "NGS-6" and a wild-type mCherry reporter; can be packaged into AAVDepositorInsertE. coli tyrosine tRNA mutant, "NGS-6"
UseAAVExpressionMammalianPromoterU6Available SinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ITR-PytR(PyOtR)-mCherry
Plasmid#204870PurposeExpresses pyrrolysyl tRNA variant "PyOtR" and a wild-type mCherry reporter; can be packaged into AAVDepositorInsertM. mazei pyrrolysyl tRNA mutant "PyOtR"
UseAAVExpressionMammalianMutationU25C; A3G, A4C, A5G, C6G, G63C, T65G, T66CPromoterU6Available SinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330 LC-FKBP-Cas9
Plasmid#162724PurposeMammalian expressionDepositorInsertFKBP F36V
UseCRISPRTags3xFLAGExpressionMammalianPromoterCBhAvailable SinceJan. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Doc2A-GFP KI
Plasmid#131478PurposeEndogenous tagging of Doc2a: C-terminal (amino acid position: L402)DepositorAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pY036_ATP1A1_G3_Array
Plasmid#86619PurposeVector for expression of a CRISPR/AsCpf1 array containing the ATP1A1 G3 guide in combination with a user-specified guide. Cloning of oligos for the second guide using BbsI sites. PY036-like plasmidDepositorInsertATP1A1 G3 crRNA + user-specified crRNA + AsCpf1-3xHA
UseCRISPR; Co-selection via nhej using ouabainTags3xHAExpressionMammalianPromoterCBhAvailable SinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
Direct-seq_lentiGuide-Puro-tRNA-Loop2-8A8G
Plasmid#157986PurposeExpresses programmed gRNA scaffold from U6 promoter. Programmed gRNA scaffold for streamlined scRNA-seq in CRISPR screen (Direct-seq). 3rd generation lentiviral backbone.DepositorInsertS. pyogenes sgRNA cassette (tRNA-Loop2-8A8G)
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceMay 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_mCherry_non-targeting
Plasmid#140109PurposeCRISPR-Cas9 library validation (negative control)DepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralPromotergRNA1 under U6 and gRNA2 under H1Available SinceApril 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSI-359
Plasmid#131131PurposegRNA expression vector for A-to-G base editing reporterDepositorInsertA-to-G reporter activation gRNA
UseCRISPRExpressionMammalianPromoterHuman U6 promoterAvailable SinceSept. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Pou5f1-g2)-PGKpuroBFP-W
Plasmid#105036PurposeLentiviral gRNA plasmid targeting mouse Pou5f1 , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
SaLgCP
Plasmid#164562PurposePuroDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsFlag-NLS-SaCas9-P2A-PuroRExpressionMammalianPromoterU6 promoter for crRNA expression and EFS promoter…Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-hIP-dCas9-BSD
Plasmid#183231PurposeLentiviral vectors with the human insulin promoter driving expression of dCas9, in addition to a U6-driven sgRNADepositorTypeEmpty backboneUseCRISPR and LentiviralPromoterHuman insulin promoterAvailable SinceOct. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO-RFP-IKZF3-sh3
Plasmid#69044Purpose3rd generation lentiviral vector expressing IKZF3 shRNADepositorAvailable SinceOct. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Puro-IFITM3g1 (BB15)
Plasmid#139460PurposeLentiviral vector with gRNA targeting IFITM3; includes puromycin selectable markerDepositorInsertIFITM3-targeting sgRNA inserted; resistance gene: puroR (IFITM3 Synthetic)
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Flag-LmoCas6
Plasmid#126485PurposeEncodes L.monocytogenes CRISPR Type I-B Cas6 with N-terminal fusion of Flag tag epitope and nuclear localization signal driven by CMV promoterDepositorInsertLmoCas6
UseCRISPRTagsFlag, NLSExpressionMammalianPromoterCMV and U6Available SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
human ETV6 gRNA-1
Plasmid#133353Purposehuman ETV6 gRNA-1 is a gRNA expression plasmid. Its 20-nt specific sequence targets the first ETV6 exon.DepositorAvailable SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSIL-eGFP-shACTN4
Plasmid#52679PurposeshRNA against α-actinin-4 with eGFP transfection markerDepositorAvailable SinceJune 10, 2014AvailabilityAcademic Institutions and Nonprofits only