We narrowed to 9,450 results for: tre promoter
-
Plasmid#192472PurposeStable expression of RvCAHS3 (fly codon optimized) in Drosophila cellsDepositorInsertCAHS3
TagsT2A-EGFP-T2A-neoRExpressionInsectPromoterAc5 promoterAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEN_TmiR_G12-E
Plasmid#25761PurposeEntry vector with TRE promoter driving mouse G alpha 12 miR30-based shRNA.DepositorInsertG alpha 12 miR-shRNA (Gna12 Mouse)
UseEntry vectorAvailable SinceJuly 14, 2010AvailabilityAcademic Institutions and Nonprofits only -
pfast bac cry1myc
Plasmid#51892PurposeBackbone plasmid is pfastBacHTa from invitrogenDepositorAvailable SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1-Eomes-3xT7
Plasmid#200888PurposeInducible lentiviral expression of EomesDepositorInsertEomes (Eomes Mouse)
UseLentiviral; Doxycycline inducibleTags3xT7ExpressionMammalianPromoterTRE promoter, Tet ONAvailable SinceJune 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
-
pCW57-Cx46-IRES-GCaMP6s
Plasmid#188238Purpose3rd generation, inducible bicistronic lentiviral plasmid for expression of human connexin 46 and GCaMP6sDepositorInsertGJA3 (GJA3 Human)
UseLentiviralTagsGCaMp6sExpressionMammalianPromoterTight TRE promoterAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGLS3-5xHRE-p53(K164R)
Plasmid#72555PurposeHypoxia induced mutant p53. Contains the HRE from VEGF sequence (5 repeats) upstream of p53 K164R.DepositorInsertp53 (TP53 Human)
Tags5XHREExpressionMammalianMutationK164RPromoterE1B minimal promoterAvailable SinceMarch 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGLS3-5xHRE-p53(K120R)
Plasmid#72554PurposeHypoxia induced mutant p53. Contains the HRE from VEGF sequence (5 repeats) upstream of p53 K120R.DepositorInsertp53 (TP53 Human)
Tags5XHREExpressionMammalianMutationK120RPromoterE1B minimal promoterAvailable SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1 _3xHA-Ago2
Plasmid#73538PurposeInducible lentiviral expression of Ago2DepositorInsertAgo2 (Ago2 Mouse)
UseLentiviralTags3xHAExpressionMammalianPromoterTRE promoter, Tet ONAvailable SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1-Gata6-3xT7
Plasmid#200889PurposeInducible lentiviral expression of Gata6DepositorInsertGata6 (Gata6 Mouse)
UseLentiviral; Doxycycline inducibleTags3xT7ExpressionMammalianPromoterTRE promoter, Tet ONAvailable SinceJune 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pETDuet-MerTK_KRmutant-PTPN1
Plasmid#196447PurposeExpression of MerTK Kinase Domain in E. coli and surface entropy reduction mutant for crystallization, coexpress PTPN1DepositorExpressionBacterialMutationK591R, K639R, K702R, K865RPromoterT7 promoterAvailable SinceMarch 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPtGE34
Plasmid#107932PurposeExpresses Cas9 in Phaeodactylum tricornutum / Encodes elements required for conjugationDepositorInsertsOriT
40SRPS8 Promoter
ShBle
40SRPS8 Terminator
Cen6-ArsH4-His3
UseCRISPR and Synthetic Biology; Episomal vector for…Available SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKE12-ISceI-fabp10a:loxP-BFP-loxP-Xla.Ctnnb1
Plasmid#198240PurposeFor I-SceI-mediated transgenesis in zebrafish; fabp10a promoter drives expression of activated β-catenin preceded by a blue fluorescent protein (BFP)-STOP cassette flanked by loxP sitesDepositorInsertsUseZebrafish transgenesisAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
BE3-P2A-EGFP (pJUL977)
Plasmid#123612PurposeCAG promoter expression plasmid for rAPOBEC1-XTEN-hSpCas9n(D10A)-UGI-NLS(SV40)-P2A-EGFP.DepositorInsertBE3-P2A-EGFP
ExpressionMammalianMutationD10A in SpCas9PromoterCAGAvailable SinceApril 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
eA3A-BE3 (pRZ206)
Plasmid#131315PurposeCAG promoter expression plasmid for hA3A(N57G)-XTEN linker-hSpCas9n(D10A)-UGI-NLS-P2A-EGFP.DepositorInserthA3A(N57G)-XTEN linker-hSpCas9n(D10A)-UGI-NLS-P2A-EGFP
ExpressionMammalianPromoterCAGAvailable SinceOct. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
NLS-nCas9-NLS-P2A-EGFP (pRZ70)
Plasmid#123616PurposeCMV promoter expression plasmid for codon-optimized bpNLS-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP (ABEmax control without TadA domains).DepositorInsertNLS-nCas9-NLS-P2A-EGFP
ExpressionMammalianMutationD10A in SpCas9PromoterCMVAvailable SinceApril 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGB2Ω2_SF-35s:hCas9:tNos (GB1103)
Plasmid#75400PurposeTranscriptional unit for (human codon optimized) Cas9 plant expression driven by the 35S promoter. Specially conceived to be linked with the TU of the kanamycin resistance gene GB1181.DepositorInserthCas9
UseCRISPR and Synthetic BiologyExpressionPlantPromoter35SAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pORANGE_Tubb3 GFP(Y39TAG) KI
Plasmid#182678PurposeExpression of spCas9, gRNA targeting the end of Tubb3 gene and donor GFP(Y39TAG). Can be used for amber codon suppression and click chemistry labeling of endogenous beta-3 tubulin in mammalian cells.DepositorExpressionMammalianPromoterU6 and chicken beta-actin promoterAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
N295A (EcN), E166Q (EcN) MetNI LmH
Plasmid#118269PurposeN295A and E166Q Mutation of MetN in Methionine ABC Transporter with 6x His Tag. Used to solve crystal structureDepositorTags6x His TagExpressionBacterialMutationChanged Glutamic Acid (Glu) 166 to Glutamine (Gln…PromoterT7 PromoterAvailable SinceNov. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
tetO-HAND2
Plasmid#170690Purposedoxycycline-inducible overexpression of HAND2DepositorInsertHAND2 (HAND2 Human)
UseLentiviral; Doxycycline inducibleExpressionMammalianPromoterTRE promoter, Tet-ONAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
FUW-tetO-wtYAP
Plasmid#84009Purposeexpresses wtYAP in mammalian cells under the control of a doxycycline-inducible promoterDepositorInsertYAP1 (siRNA insensitive) (YAP1 Human)
UseLentiviralTagsFLAGExpressionMammalianPromoterTRE-CMVAvailable SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV hPGRN
Plasmid#213682PurposeExpresses human progranulin (PGRN) with an N-terminal twin-Strep-V5 tagDepositorInsertHuman Progranulin (hPGRN) (GRN Human)
UseAAVTagsTwin-Strep tag and V5 tag (after signal peptide)Promotercytomegalovirus enhancer/chicken β-actin promoterAvailable SinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1 _3xHA-Ago2_RNAmut
Plasmid#73539PurposeInducible lentiviral expression of Ago2_RNAmutDepositorInsertAgo2 (Ago2 Mouse)
UseLentiviralTags3xHAExpressionMammalianMutationSmall RNA binding mutant PAZ domain Y311A and F31…PromoterTRE promoter, Tet ONAvailable SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1 _3xHA-Ago2_CATmut
Plasmid#73540PurposeInducible lentiviral expression of Ago2_CATmutDepositorInsertAgo2 (Ago2 Mouse)
UseLentiviralTags3xHAExpressionMammalianMutationCatalytic mutant PIWI domain D670APromoterTRE promoter, Tet ONAvailable SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGLS3-5xHRE-p53(K120R/K164R)
Plasmid#72556PurposeHypoxia induced mutant p53. Contains the HRE from VEGF sequence (5 repeats) upstream of p53 K120R/K164R.DepositorInsertp53 (TP53 Human)
Tags5XHREExpressionMammalianMutationK120R/K164RPromoterE1B minimal promoterAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp High Copy FAM136A-HA WT
Plasmid#244883PurposeIn vitro transcription of wild-type FAM136A downstream of SP6 promoterDepositorAvailable SinceOct. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp High Copy ENDOG-HA
Plasmid#244881PurposeIn vitro transcription of human ENDOG downstream of SP6 promoterDepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hGRN4
Plasmid#213684PurposeExpresses human granulin-4 with an N-terminal twin-Strep-FLAG tagDepositorInsertHuman granulin-4 (hGRN4) (GRN Human)
UseAAVTagsTwin-Strep tag and FLAG tag (after signal peptide…Promotercytomegalovirus enhancer/chicken β-actin promoterAvailable SinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEMS1494
Plasmid#29242PurposePleiades (Ple) MiniPromoter expression pattern described in de Leeuw et al., MTM, 2014 (PMID: 24761428).DepositorInsertPle23 (CCKBR Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceNov. 7, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1493
Plasmid#29241PurposePleiades (Ple) MiniPromoter expression pattern described in de Leeuw et al., MTM, 2014 (PMID: 24761428).DepositorInsertPle22 (CCKBR Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceNov. 7, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
FUW-tetO-YAPS94A
Plasmid#84010Purposeexpresses a TEAD-binding mutant of YAP (YAPS94A) in mammalian cells under the control of a doxycycline-inducible promoterDepositorInsertYAP1 (siRNA insensitive) (YAP1 Human)
UseLentiviralTagsFLAGExpressionMammalianMutationS94APromoterTRE-CMVAvailable SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGS-BacA-21222-SNF5
Plasmid#109186PurposePlasmid for expression of C-terminally 3xFLAG-tagged SNF5 under the control of a polh promoter in baculovirus/insect cell systemsDepositorAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
Target-AID (pRZ762)
Plasmid#131300PurposeCAG promoter expression plasmid for NLS-hSpCas9n(D10A)-NLS-SH3-3xFLAG-pmCDA1(R187W with reference to NCBI ABO15149.1)-NLS-UGI-P2A-EGFP.DepositorInsertNLS-hSpCas9n(D10A)-NLS-SH3-3xFLAG-pmCDA1(R187W with reference to NCBI ABO15149.1)-NLS-UGI-P2A-EGFP
ExpressionMammalianPromoterCAGAvailable SinceOct. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
nCas9-UGI-NLS-P2A-EGFP (pJUL1001)
Plasmid#123611PurposeCAG promoter expression plasmid for hSpCas9n(D10A)-UGI-NLS(SV40)-P2A-EGFP (BE3 control without rAPOBEC1).DepositorInsertnCas9-UGI-NLS-P2A-EGFP
ExpressionMammalianMutationD10A in SpCas9PromoterCAGAvailable SinceApril 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDH-CMV-V5-RFP-SLMAP (isoform r)
Plasmid#235685PurposeExpress RFP tagged SLMAP gene in mammalian cells using the CMV promoterDepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-bpNLS-hPol eta-2A-tagBFP-bGHpA
Plasmid#193968PurposeEncodes a wildtype human Pol? (eta) with P2A-tagBFP marker driven by CAG promoterDepositorAvailable SinceJan. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-CMV-HA-CFP-SLMAP (isoform r)
Plasmid#235684PurposeExpress CFP tagged SLMAP gene in mammalian cells using the CMV promoterDepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDH-CMV-V5-RFP-MST2
Plasmid#235688PurposeExpress RFP tagged MST2 gene in mammalian cells using the CMV promoterDepositorAvailable SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only