We narrowed to 12,110 results for: NSI
-
Plasmid#203167PurposeYeast expression vector for hNUS1 R290HDepositorAvailable SinceAug. 29, 2023AvailabilityAcademic Institutions and Nonprofits only
-
mEos3.2trLATm2allL+A
Plasmid#203750PurposeEncodes the transmembrane domain from human LAT with mEos3.2 fused on the C terminus. Residues within the transmembrane domain mutated to L and A to increase the TMD interfacial surface area with the membrane. Used as a fluorescent plasma membrane probe.DepositorAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-CHMP2A-myc, L216D/L219D
Plasmid#180645PurposeMammalian expression of CHMP2A with L216D/L219D mutations. Has C-terminal Myc tag. Internal ID:WISP20-13.DepositorAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-OSF-KATNA1 R14A
Plasmid#160052PurposeMammalian expression vector for KATNA1 (KATANIN-P60) R14A mutant with N-terminal One-Strep-Flag tag. Internal ID: WISP20-19.DepositorAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-OSF-KATNA1 V55D
Plasmid#160053PurposeMammalian expression vector for KATNA1 (KATANIN-P60) V55D mutant with N-terminal One-Strep-Flag tag. Internal ID: WISP20-17.DepositorAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA528 KATNA1 MIT residues 1-79, V55D
Plasmid#180615PurposeBacterial expression for KATNA1 MIT domains, residues 1-79. Has V55D mutation. Has N-terminal HIS-SUMO tag. Internal ID: WISP20-23.DepositorInsertKATNA1 (KATNA1 Human)
TagsHIS-SUMOExpressionBacterialMutationResidues 1-79, V55D mutationPromoterT7Available SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC19-π-EB1_IRES-mCherry
Plasmid#197427PurposeHomology-directed repair template targeting IRES-based π-element to MAPRE1 exon 5DepositorInsertIRES-based π-element with HDR templates flanking MAPRE1 exon 5 insertion site (MAPRE1 Human)
UseCRISPR and Synthetic BiologyTagsGCN4 leucine zipper, LOV2, Zdk1, and mCherryAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC19-π-EB1_EF1α-mCherry
Plasmid#197429PurposeHomology-directed repair template targeting EF1α-based π-element to MAPRE1 exon 5DepositorInsertEF1α-based π-element with HDR templates flanking MAPRE1 exon 5 insertion site (MAPRE1 Human)
UseCRISPR and Synthetic BiologyTagsGCN4 leucine zipper, LOV2, Zdk1, and mCherryAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC19-π-EB1_EF1α-EGFP
Plasmid#197430PurposeHomology-directed repair template targeting EF1α-based π-element to MAPRE1 exon 5DepositorInsertEF1α-based π-element with HDR templates flanking MAPRE1 exon 5 insertion site (MAPRE1 Human)
UseCRISPR and Synthetic BiologyTagsEGFP, GCN4 leucine zipper, LOV2, and Zdk1Available SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
hTln1-R1R2
Plasmid#191440PurposeExpresses the human TLN1 R1R2 domains in bacteriaDepositorAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-TRE3G_NT-GSDMD_I105N_NoCys
Plasmid#201177PurposeDox-inducible expression of NT-GSDMD gene in mammalian cells by retroviral transductionDepositorInsertGasdermin D N-terminal domain (Gsdmd Mouse)
UseRetroviralMutationaa1-276 only, I105N, C39A, C57A, C77A, C122A, C2…PromoterTRE3GAvailable SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-TRE3G_NT-GSDMD_I105N_C192only
Plasmid#201178PurposeDox-inducible expression of NT-GSDMD gene in mammalian cells by retroviral transductionDepositorInsertGasdermin D N-terminal domain (Gsdmd Mouse)
UseRetroviralMutationaa1-276 only, I105N, C39A, C57A, C77A, C122A, C2…PromoterTRE3GAvailable SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-TRE3G_NT-GSDMD_NoCys
Plasmid#201173PurposeDox-inducible expression of NT-GSDMD gene in mammalian cells by retroviral transductionDepositorInsertGasdermin D N-terminal domain (Gsdmd Mouse)
UseRetroviralMutationaa1-276 only, C39A, C57A, C77A, C122A, C265A, C19…PromoterTRE3GAvailable SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
H6GB1tev-IntC-P53(304-393)
Plasmid#200315Purposebacterial expression of P53 TETCTD for segmental labelingDepositorInsertp53 (304-393) (TP53 Human)
TagsHis6GB1tev and designed intein CExpressionBacterialPromoterT7Available SinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
hPCNA-C148S
Plasmid#190939Purposeuntagged human PCNA with a cysteine to serine mutationDepositorInsertProliferating Cell Nuclear Antigen (PCNA Human)
ExpressionBacterialMutationchanged cysteine 148 to serinePromoterT7Available SinceMarch 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pROS_phleo-Tps1/Gsy2
Plasmid#196612PurposeEncoding guide RNAs for the knock out of TPS1 and GSY2 genesDepositorAvailable SinceMarch 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pROS13-Tps2/Gsy1
Plasmid#196613PurposeEncoding guide RNAs for the knock out of TPS2 and GSY1 genesDepositorAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUGP1.1
Plasmid#196615PurposePlasmid used for the C-terminal tagging of Ugp1 with mCherry and the auxin-inducible degron in yeastDepositorInsertUGP1::mCherry-AID(71-114)-NatMX (UGP1 Budding Yeast)
TagsAID(71-114) and mCherryExpressionYeastPromoterNative promoterAvailable SinceMarch 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459_V2.0_pSpCas9(BB)-2A-Puro_T-REX17_Ex1_KI
Plasmid#195504PurposeCas9-2A-Puro expression vector bearing a sgRNA targeting Exon 1 of human lncRNA T-REX17DepositorInsertsgRNA
UseCRISPRTags3XFLAG, Puro, and T2AExpressionMammalianPromoterU6Available SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
Coexpressed VLP NES
Plasmid#182433PurposeYeast integrative plasmid for expressing Murine polyomavirus deltaVP1 (GAL1 promoter), VP2C-ERG20 (GAL10 promoter), and VP2C-AcNES1 (GAL7 promoter). Contains uracil auxotrophic marker (K. lactis URA3)DepositorInsertsVP2C-FPPS
deltaVP1
VP2C-NES
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL1, GAL10, and GAL7Available SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
Coexpressed VLP NES (M)
Plasmid#182435PurposeYIp for expressing Murine polyomavirus deltaVP1 (GAL1 promoter), VP2C-ERG20(F96W-N127W) (GAL10 promoter), and VP2C-AcNES1 (GAL7 promoter). Contains uracil marker (K. lactis URA3).DepositorInsertsVP2C-FPPS(M)
deltaVP1
VP2C-NES
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL1, GAL10, and GAL7Available SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
Coexpressed VLP NES (G)
Plasmid#182477PurposeYIp for expressing Murine polyomavirus deltaVP1 (GAL1 promoter), VP2C-ERG20(F96C) (GAL10 promoter), and VP2C-AcNES1 (GAL7 promoter). Contains uracil marker (K. lactis URA3).DepositorInsertsVP2C-FPPS(G)
deltaVP1
VP2C-NES
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL1, GAL10, and GAL7Available SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
Linked Free NES (AG4TGGA)2
Plasmid#182488PurposeYeast integrative plasmid for expressing fusion protein ERG20-AcNES1, with linker sequence (AG4TGGA)2 (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertFPPS-NES
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL10Available SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
Linked Free (PT)4P
Plasmid#182490PurposeYeast integrative plasmid for expressing fusion protein ERG20-AcNES1, with linker sequence PTPTPTPTP (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertFPPS-NES
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL10Available SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dTLN1 exon
Plasmid#176033PurposeA vector for the CRISPR-Cas9 system targeting an exon of dog TLN1 (talin1)DepositorInsertA gRNA targeting the dog TLN1 gene and the cDNA of Cas9 (TLN1 )
UseCRISPRExpressionMammalianAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dTLN1 intron
Plasmid#176224PurposeA vector for the CRISPR-Cas9 system targeting an intron of dog TLN1 (talin1)DepositorInsertA gRNA targeting the dog TLN1 gene and the cDNA of Cas9 (TLN1 )
UseCRISPRExpressionMammalianAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCSmChnERT(#99)
Plasmid#184063Purposecyclofen-inducible mCherry nuclear relocation via mammalian cell transfection or mRNA synthesisDepositorInsertmCherry-nls-ERT2
UseSynthetic BiologyExpressionMammalianMutationERT2: G400V, M543A, L544A, deleted 1-281;PromotersCMV+SP6Available SinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_PDHA2S291D
Plasmid#115193PurposeLentiviral transduction and expression of PDHA2S291D into any mammalian cellDepositorAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_PDHA2S293D
Plasmid#115194PurposeLentiviral transduction and expression of PDHA2S293D into any mammalian cellDepositorAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_PDHA2S291D/S293D
Plasmid#115195PurposeLentiviral transduction and expression of PDHA2S291D/S293D into any mammalian cellDepositorAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLPC-FLAG.Mm.EPC1.delta.EPcA
Plasmid#184655PurposeRetroviral expression of mouse EPC1 delta EPcADepositorInsertEpc1 (Epc1 Mouse)
UseRetroviralTagsFLAGExpressionMammalianMutationepc1 delta EPcAPromoterCMVAvailable SinceJune 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT22iU66CriT(#387)
Plasmid#184061Purposecyclofen-inducible CRE activation in zebrafish permanent transgenicDepositorInsertCRE-ERT2
UseZebrafish transgenesis (blue eyes)MutationERT2: G400V, M543A, L544A, deleted 1-281;PromoterZf-UbiAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLPC-Flag.Mm.Epc1-EPcA
Plasmid#184657PurposeRetroviral expression of mouse Epc1 EPcADepositorInsertEpc1 (Epc1 Mouse)
UseRetroviralTagsFLAGExpressionMammalianMutationEpc1-EPcAPromoterCMVAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLPC-MYC.Mm.DMAP1
Plasmid#184651PurposeRetroviral expression of mouse Dmap1DepositorAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLPC-FLAG.Mm.EPC1.delta.EPcC
Plasmid#184656PurposeRetroviral expression of mouse EPC1 delta EPcCDepositorInsertEpc1 (Epc1 Mouse)
UseRetroviralTagsFLAGExpressionMammalianMutationEpc1 delta EPCc.QTPromoterCMVAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA Td1
Plasmid#176257PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 1DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a-Nlux_crRNA NR2
Plasmid#176245PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 2DepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_crRNA NR2
Plasmid#176248PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence without Nlux tag and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 2DepositorInserthumanized fnCas12a
UseCRISPR and Synthetic Biology; Expression in micro…Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only