We narrowed to 1,263 results for: nms
-
Plasmid#61677PurposeGFP-labeled SAH scaffold with split GFP attachment siteDepositorInsertmEGFP-30nmSAH-GFP(1-10)
Available SinceMarch 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
SNAP-EF(N)-5nmSAH-GFP(1-10)
Plasmid#61659Purpose5nm SAH scaffold with EF Hand and split GFP attachment sitesDepositorInsertSNAP-EF(N)-5nmSAH-GFP(1-10)
ExpressionMammalianAvailable SinceMarch 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
SNAP-EF(N)-30nmSAH-GFP(1-10)
Plasmid#61662Purpose30nm SAH scaffold with EF Hand and split GFP attachment sitesDepositorInsertSNAP-EF(N)-30nmSAH-GFP(1-10)
ExpressionMammalianAvailable SinceMarch 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
SNAP-EF(N)-20nmSAH-GFP(1-10)
Plasmid#61661Purpose20nm SAH scaffold with EF Hand and split GFP attachment sitesDepositorInsertSNAP-EF(N)-20nmSAH-GFP(1-10)
ExpressionMammalianAvailable SinceMarch 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAIDFA-EF1a-NmScarlet-mAID
Plasmid#140615PurposeExpression of OsTIR1F74A and mScarlet-mAID protein in mammalian cells under the control of EF1a promoterDepositorInsertOsTIR1 mutated F74A
ExpressionMammalianAvailable SinceSept. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAID1.2-EF1a-NmScarlet-mAID
Plasmid#140617PurposeExpression of OsTIR1 and mScarlet-mAID protein in mammalian cells under the control of EF1a promoterDepositorInsertOsTIR1
ExpressionMammalianAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAIDFA-CMV-NmScarlet-mAID
Plasmid#140616PurposeExpression of OsTIR1F74A and mScarlet-mAID protein in DT40 cells under the control of CMV promoterDepositorInsertOsTIR1 mutated F74A
ExpressionMammalianAvailable SinceSept. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAID1.2-CMV-NmScarlet-mAID
Plasmid#140618PurposeExpression of OsTIR1 and mScarlet-mAID protein in DT40 cells under the control of CMV promoterDepositorInsertOsTIR1
ExpressionMammalianAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
NM R2E2 GFP
Plasmid#1208DepositorInsertsup35 NM domain (SUP35 Budding Yeast)
TagsGFPExpressionYeastMutation2 additional copies of second oligopeptide repeat…Available SinceMay 25, 2005AvailabilityAcademic Institutions and Nonprofits only -
M-NM-sgRNA
Plasmid#48673PurposeMammalian U6-driven sgRNA (NMm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with N. meningitidis Cas9, hU6 promoter
UseCRISPRPromoterhU6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-NM
Plasmid#48679PurposeMammalian tdTomato activation reporter for NM with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, NM-PAM, and tdTomato reporter. Compatible with N. meningitidis Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2T-NM
Plasmid#1127DepositorAvailable SinceMarch 14, 2006AvailabilityAcademic Institutions and Nonprofits only -
PM-NM!TA
Plasmid#48651PurposeBacterial NM crRNA expression: targets NM to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial NM crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-NM!TB
Plasmid#48652PurposeBacterial NM crRNA expression: targets NM to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial NM crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
SK-YFP-NM-A
Plasmid#48664PurposeBacterial NM repression YFP reporter: protospacer ADepositorInsertNM prototspacer A/PAM with reporter EYFP
UseCRISPRPromoterlambda pR promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
AAV-AIO-M11-gRNA-EFS-NMS-SadCas9
Plasmid#210710PurposeThis Plasmid express M11 promoter driven SadCas9 specific gRNA and EFS promoter driven NMS transactivation module fused to SadCas9DepositorInsertSadCas9 specific gRNA and NMS fused to N-terminus of SadCas9
UseAAV and CRISPRTagsFLAGExpressionMammalianMutationD10A/N580APromoterM11Available SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSmart-Nm-sgRNA-BbsI
Plasmid#49157PurposePlasmid for cloning spacer into sgRNA for NmCas9DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.3-Nm-dCas9-p300 Core
Plasmid#61365Purposeencodes N. meningiditis dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664) driven by CMV promoterDepositorInsertNm-dCas9-p300 Core (EP300 Human, Synthetic, Neisseria meningiditis)
UseCRISPR and Synthetic BiologyTagsHA tag and NLSExpressionMammalianMutationD16A, D587A, H588A, N611A in Nm Cas9PromoterCMVAvailable SinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pZDonor-Nm-Cas9-gRNA-hU6
Plasmid#61366Purposeempty backbone for cloning N. meningiditis protospacers. Encodes constant region of N. meningiditis Cas9 synthetic gRNADepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionMammalianPromoterhuman U6Available SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only