We narrowed to 15,168 results for: Egf
-
Plasmid#204544PurposeExpresses EGFP-tagged MVP delta607-623aa in mammalian cellsDepositorAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-HDR-mEGFP-Actin
Plasmid#119870PurposeAAV vector including gRNA expression cassette and mEGFP knock-in donor targeting mouse Beta ActinDepositorInsertbeta Actin (Actb Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-144:CTCF-mEGFP
Plasmid#168799PurposeHomology arms and mEGFP-linker sequence sequence for N-terminus tagging of human CTCFDepositorInsertCTCF (CTCF Human)
UseCRISPR; Donor templateTagsmEGFP-linkerExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceJune 10, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-hSyn1-DIO-eGFP
Plasmid#227237PurposeLarge capacity AAV that expresses eGFP in neurons expressing Cre recombinaseDepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
Str-Ii_VSVG-SBP-EGFP
Plasmid#65300Purposesynchronize trafficking of VSVG from the ER (RUSH system)DepositorInsertVSV-G
TagsEGFP and Streptavidin Binding Protein (SBP)ExpressionMammalianPromoterCMVAvailable SinceAug. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
TetOn-mCherry-eGFP-RAMP4
Plasmid#109014PurposeTet-On construct to induce expression of tandem eGFP-mCherry tagged RAMP4 (ER marker)DepositorInsertRAMP4 (SERP1 Human)
UseLentiviralTagsmCherry-eGFPExpressionMammalianPromoterCMV promoterAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pdest N-FLAG EGFP puro
Plasmid#223056PurposeEGFP gene expression in mammalian cellsDepositorInsertEGFP
UseLentiviralTagsFLAGExpressionMammalianPromoterCMVAvailable SinceFeb. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_miniSOG2 T2A H2B-EGFP
Plasmid#87410PurposeMammalian expression vector encoding Histone 2B GFP fusion and miniSOG2DepositorInsertmini singlet oxygen generator 2
ExpressionMammalianAvailable SinceMarch 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-DIO-TC66T-2A-EGFP-2A-oG
Plasmid#178429PurposeExpresses TVA(TC66T), EGFP, and optimized Rabies G (oG) protein in a FLEX cassetteDepositorInsertsTVA950 Glu66→Thr
Optimized G
EGFP
UseAAV and Cre/Lox; Adeno-associated virusPromoterhSynAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLJC5-3xHA-eGFP-OMP25
Plasmid#239249Purpose3xHA-eGFP-OMP25 lentiviral overexpression vectorDepositorAvailable SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-ALFA
Plasmid#242764PurposeAAV transfer plasmid expressing eGFP-ALFA under a CAG promoter.DepositorInsertEGFP
UseAAVTagsALFAPromoterCAGAvailable SinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-EGFP-KASH
Plasmid#154373PurposeVector for Cre-dependent expression of EGFP tagged KASH protein domainDepositorInsertEGFP-KASH
UseAAV and Cre/LoxExpressionMammalianAvailable SinceAug. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-166:CDH1-mEGFP
Plasmid#193921PurposeHomology arms and LE-mEGFP sequence for C-terminus tagging of human cadherin 1DepositorInsertcadherin 1 Homology Arms with LE-mEGFP (CDH1 Human)
UseAAV and CRISPR; Donor templateTagslinker-mEGFPMutationhomology arms contain point mutations to disrupt …Available SinceDec. 22, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
JT504: pMVP/SB/eGFP-DEST
Plasmid#121861PurposepMVP destination vector, empty Sleeping Beauty transposon vector backbone w/ eGFP selection cassetteDepositorTypeEmpty backboneUseSleeping beauty transposon, pmvp gateway destinat…ExpressionMammalianAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/TO-eGFP-53BP1
Plasmid#60813Purposemammalian expression vectorDepositorAvailable SinceDec. 9, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
3xFlag-eGFP-Flag-SETX
Plasmid#218838PurposeMammalian expression of GFP-tagged SETX construct for subcellular localization studies with GFP, or immunoprecipitation with Flag tag.DepositorAvailable SinceJune 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-HDR-mEGFP-camk2a
Plasmid#104589PurposeAAV vector including gRNA expression cassette and mEGFP knock-in donor targeting mouse camk2aDepositorInsertcalcium/calmodulin-dependent protein kinase II alpha (Camk2a Mouse)
UseAAV, CRISPR, and Mouse TargetingPromoterNoneAvailable SinceDec. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
EGFR D770-N771 insNPG
Plasmid#11016PurposeRetroviral construct for expressing human EGFR with D770-N771 insNPG mutation in human cellsDepositorInsertEGFR D770-N771 insNPG (EGFR Human)
UseRetroviralExpressionMammalianMutationD770-N771 insNPGAvailable SinceDec. 2, 2005AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N2-2XNLS-RNaseH1 delta 1-27 (WT)
Plasmid#196702PurposePlasmid for transient mammalian expression of wild type RNase H1 tagged with 2xNLS and EGFP that can be used to specifically degrade the nuclear R-loops.DepositorInserthuman RNaseH1 wild type
ExpressionMammalianAvailable SinceMarch 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only