We narrowed to 7,812 results for: sms
-
Plasmid#191480PurposeLuciferase reporter for SARS-CoV-2 5' UTRDepositorInsertSARS-CoV-2 5' UTR
UseLentiviral and LuciferaseMutationcontains SARS-CoV-2 5' UTRAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
p23-NES-PguCas13b-msfGFP-NES-Flag
Plasmid#165072Purposeoverexpression of PguCas13b in human cellsDepositorInsertPguCas13b
UseLentiviralExpressionMammalianAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
MSCV-human HoxB4-IRES-YFP
Plasmid#91889PurposeRetroviral expression of human HoxB4DepositorAvailable SinceJuly 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-Bsd-CMV-hUCK
Plasmid#195141PurposeUCK2 overexpression vector with blasticidin resistanceDepositorInsertUCK2 (UCK2 Human)
ExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-1:PXN-EGFP
Plasmid#87420PurposeHomology arms and linker-EGFP sequence for C-terminus tagging of human PXNDepositorInsertPXN Homology Arms with linker-EGFP (PXN Human)
UseCRISPR; Donor templateTagslinker-EGFPExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceMarch 15, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
G protein alpha-q-YFP
Plasmid#55782PurposeThis G protein alpha-q construct contains internal insertions of YFP and the EE epitope.DepositorInsertalpha-q EE YFP (Gnaq Mouse)
TagsThe EE epitope was introduced into the alpha-q se…ExpressionMammalianMutationBamHI and SacI sites in alpha-q were removed with…PromoterCMVAvailable SinceAug. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
sg_Trp53_i4-ipUSEPR-TR657
Plasmid#228930PurposeKnockdown of Trp53 in mammalian cellsDepositorInsertsg_Trp53_i4 (Trp53 Mouse, sequence: GTCGCTACCTACAGCCAGGA)
UseLentiviralAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
sg_Cdkn1a_i1-ipUSEPR-TR657
Plasmid#228953PurposeKnockdown of Cdkn1a in mammalian cellsDepositorInsertsg_Cdkn1a_i1 (Cdkn1a Mouse)
UseLentiviralAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
sg_Cdkn1a_i2-ipUSEPR-TR657
Plasmid#228954PurposeKnockdown of Cdkn1a in mammalian cellsDepositorInsertsg_Cdkn1a_i2 (Cdkn1a Mouse)
UseLentiviralAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti_EF1a_Flag_TP53_R248W+P278A
Plasmid#183115PurposeExpresses flag-tagged p53 with both R248W and P278A mutations in mammalian cellsDepositorInsertTP53 (TP53 Human)
UseCRISPR and LentiviralTagsFLAGExpressionMammalianMutationchanged proline 278 to alanine and arginine 248 t…PromoterEF1aAvailable SinceAug. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
VRK1-dTag-puro
Plasmid#199651PurposeExpresses VRK1 C-term. Tagged with dTAGDepositorAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
Chr1q_Centromere-Targeting_gRNA
Plasmid#195125PurposegRNA targeting centromere-proximal location on Chromosome 1q in a third generation Cas9 backbone with GFPDepositorInsertChr1q gRNA
ExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV8-hSyn-flex-miR30-eGFP-shDyn
Plasmid#132716PurposeEncodes Cre-dependent short hairpin RNA (shRNA) that targets the 3’-untranslated region of the rat Pdyn gene, which encodes dynorphinDepositorAvailable SinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
CaTCH Dual-sgRNA_sgBC1-A_sgBC1-C
Plasmid#154196PurposeLentiviral expression plasmid encoding two sgRNAs for targeting of the CaTCH barcode cassette BC1. Expresses Thy1.1 and a Neo selection marker.DepositorInsertsgRNA-BC1-A, sgRNA-BC1-C
UseLentiviral; Catch barcode activationExpressionMammalianPromoterhU6 and mU6Available SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
Seattle_IPDA_control_1_001
Plasmid#167347PurposeddPCR gating control for droplets containing all 5 targets (2 in pol)DepositorInsertpol_gag_tat_env
UseOtherAvailable SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1-3xMBT_D355N
Plasmid#46988PurposeInducible expression of 3xMBT (D355N) from L3MBTL1 as a GST fusion protein in E.coliDepositorInsertTriple MBT domain from human L3MBTL1 (L3MBTL1 Human)
TagsGST and PreScission cleavage siteExpressionBacterialMutationMutation aspartic acid 355 to asparagine (D355N);…PromotertacAvailable SinceSept. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
LentiRCas9-CUG
Plasmid#104183PurposeLentiviral transfer vector that carries U6-driven sgRNA targeting CUG repeats using a modified scaffold (Chen et al. Cell 2013) and CMV-driven PIN-dCas9. Derived from LentiCRISPR v2 (Zhang lab)DepositorInsertU6-CUGsgRNA, EFS-PIN-dCas9
UseCRISPR and LentiviralAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR-53BP1 1-1972 WT
Plasmid#53446PurposeRecombinational donor/master vectorDepositorInsert53BP1 (TP53BP1 Human)
UseGatewayMutationsiRNA resistant and mutations A128V, T720A, A1347…Available SinceApril 10, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
Seattle_IPDA_control_9_003
Plasmid#167349PurposeddPCR gating control for droplets containing either gag+env targets OR tat + env targetsDepositorInsertgag_tat_env
UseOtherAvailable SinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
Seattle_IPDA_control_6_002
Plasmid#167348PurposeddPCR gating control for droplets containing either gag+5'pol targets OR 3'pol+tat targetsDepositorInsertpol_gag_tat
UseOtherAvailable SinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only