We narrowed to 6,267 results for: cat.2
-
Plasmid#209007PurposeRecombinant protein expression of truncated syt1 constructDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pMM119
Plasmid#127213PurposeBeYDV replicon with constitutive GFP expression, WUS2, sgRNA targeting PDSDepositorInsertGFP, WUS2, sgRNA
ExpressionPlantMutationcodon optimized CDSsAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHR-H13LTat-CD8a/d2eGFP-IRES-Nef
Plasmid#126552PurposeReplication incompetent HIV with H13L Tat and d2eGFP/CD8a reporterDepositorInsertHIV-1 vector pNL4-3
UseLentiviralTagsCD8a and GFPMutationDelta gag/polPromoterHIV LTRAvailable SinceJuly 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO-PTEN-shRNA-3001
Plasmid#25639DepositorAvailable SinceJune 21, 2010AvailabilityAcademic Institutions and Nonprofits only -
pHR-H13LTat-Thy1.2-P2A-GFP-T2A-Nef
Plasmid#126553PurposeReplication incompetent HIV with H13L Tat and GFP-t2a-Thy1.2 reporterDepositorInsertHIV-1 vector pNL4-3
UseLentiviralTagsThy1.2 and GFPPromoterHIV LTRAvailable SinceJuly 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMM134
Plasmid#127215PurposeBeYDV replicon with constitutive Luc expression, IPT, sgRNA targeting PDSDepositorInsertLuc, IPT, sgRNA
ExpressionPlantMutationcodon optimized CDSsAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMM146
Plasmid#127218PurposeBeYDV replicon with constitutive Luc expression, BBM, sgRNA targeting PDSDepositorInsertLuc, BBM, sgRNA
ExpressionPlantMutationcodon optimized CDSsAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMM135
Plasmid#127216PurposeBeYDV replicon with constitutive Luc expression, WUS2, sgRNA targeting PDSDepositorInsertLuc, WUS2, sgRNA
ExpressionPlantMutationcodon optimized CDSsAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMM136
Plasmid#127217PurposeBeYDV replicon with constitutive Luc expression, MP-delta, sgRNA targeting PDSDepositorInsertLuc, MP-delta, sgRNA
ExpressionPlantMutationcodon optimized CDSsAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMM131
Plasmid#127214PurposeBeYDV replicon with constitutive Luc expression, AtSTM, sgRNA targeting PDSDepositorInsertLuc, AtSTM, sgRNA
ExpressionPlantMutationcodon optimized CDSsAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSN007
Plasmid#102440PurposeFor PCR amplification to create paired gRNAs to clone into Golden Gate gRNA expression vectors (e.g. pSB700 Plasmid #64046)DepositorInsert7SK paired gRNA insert
UseSynthetic BiologyExpressionBacterialAvailable SinceAug. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTK162_mCherry-4.1G-hardened
Plasmid#46361DepositorInsert4.1G (EPB41L2 Human)
TagsmCherryExpressionMammalianMutationModified for siRNA resistance to gcTccTcaTttCgaAc…PromoterCMVAvailable SinceJuly 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET21b-hHNF4aORF-1
Plasmid#206959PurposeThe ORF of HNF4α (variant 2) cDNA amplified from the RT human liver RNA was cloned at the NheI/NotI sites of the pET21b(+), the bacterial expression vector.DepositorInsertHNF4a (Hepatocyte Nuclear Factor alpha4 Variant 2) (HNF4A Human)
ExpressionBacterialPromoterT7Available SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR3_BC6
Plasmid#191861PurposeBarcoded plasmid with BsaI sites to clone sgRNA. The 6-nucleotide barcode (sequence: CCTAGT) near the sgRNA insert region enables demultiplexing replicates while sequencing the sgRNA region.DepositorTypeEmpty backboneUseCRISPRAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR3_BC5
Plasmid#191860PurposeBarcoded plasmid with BsaI sites to clone sgRNA. The 6-nucleotide barcode (sequence: AGTCTA) near the sgRNA insert region enables demultiplexing replicates while sequencing the sgRNA region.DepositorTypeEmpty backboneUseCRISPRAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR3_BC4
Plasmid#191859PurposeBarcoded plasmid with BsaI sites to clone sgRNA. The 6-nucleotide barcode (sequence: GTATGA) near the sgRNA insert region enables demultiplexing replicates while sequencing the sgRNA region.DepositorTypeEmpty backboneUseCRISPRAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR3_BC1
Plasmid#191856PurposeBarcoded plasmid with BsaI sites to clone sgRNA. The 6-nucleotide barcode (sequence: CTTTCA) near the sgRNA insert region enables demultiplexing replicates while sequencing the sgRNA region.DepositorTypeEmpty backboneUseCRISPRAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP01
Plasmid#186260PurposesfGFP under light light responsive PEL222 promoterDepositorInsertsfGFP
ExpressionBacterialPromoterPEL222 (GGTAGCCTTTAGTCCATGTTAGCGAAGAAAATGGTTTGTTA…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
HA-HA-AR-NTD
Plasmid#171235PurposeMammalian expression of 2xHA-tagged human androgen receptor trancate: AR N-terminal-domain (NTD)DepositorInsert2xHA-tagged human androgen receptor trancate: N-terminal-domain (AR Human)
TagsHAExpressionBacterial and MammalianMutationAR truncatePromoterCMVAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
HA-HA-AR-DBD
Plasmid#171238PurposeMammalian expression of 2xHA-tagged human androgen receptor trancate: AR DNA-bindind domain (DBD)DepositorInsert2xHA-tagged human androgen receptor trancate:DNA-binding domain (AR Human)
TagsHAExpressionBacterial and MammalianMutationAR truncatePromoterCMVAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only