We narrowed to 12,286 results for: shRNA
-
Plasmid#100294PurposeCCR5-targeting gRNA expression plasmidDepositorInsertgRNA spacer
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterU6 RNA Pol III promoter human snRNAAvailable SinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(2)
Plasmid#136059PurposeG3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
sg14x(MS2) MUC4.1
Plasmid#101153PurposegRNA with 14 MCP binding siteDepositorInsertMUC4 (MUC4 Human)
UseCRISPR and LentiviralAvailable SinceNov. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(1)
Plasmid#136058PurposeG3BP1 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTAGTCCCCTGCTGGTCGGGC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_TYMS
Plasmid#183326PurposeAll-in-One CRISPRko system with a guide RNA that targets TYMS geneDepositorInsertTYMS
UseLentiviralAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
D. vulgaris sp2 CRISPR/pACYCDuet-1
Plasmid#81186PurposeExpresses CRISPR array containing 3 copies of Desulfovibrio vulgaris spacer 2 and flanking repeats in E. coliDepositorInsertSynthetic CRISPR array (3 copies of D. vulgaris spacer #2 flanked by repeats)
UseCRISPRTagsNoneExpressionBacterialPromoterT7Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Sa-gRNA-puro
Plasmid#191652PurposeLentiviral expression of puromycin resistance gene and S. aureus scrambled non-targeting gRNA ; useful for changing gRNA by mutagenesis.DepositorInsertS. aureus gRNAscr
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
L4440_BioBrick-SCR-sgRNA-B
Plasmid#177812PurposeOverexpression of sgRNAs in E. coli HT115 (scrambled targeting sequences)DepositorInsertScrambled sgRNA targeting sequences
ExpressionBacterialAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lsg-GBA-1 + 2
Plasmid#199276Purposenicking sgRNA to induce or correct GBA (c. 1226 A > G) mutation using PE3DepositorInsertGBA nick
ExpressionMammalianAvailable SinceApril 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
lenti-EGFR-L858R-tmpknot-epegRNA
Plasmid#214092PurposeLentiviral vector expressing epegRNA to induce EGFR L858R mutationDepositorInsertEGFR L858R epegRNA
UseLentiviralExpressionMammalianPromoterhU6Available SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pV1382
Plasmid#111436PurposeS. cerevisiae and C. glabrata Solo CRISPR vector, marked with URA3 and NatRDepositorInsertCaCas9/sgRNA-BsmBI stuffer
UseCRISPRExpressionYeastAvailable SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
sgRNA 1 GAPDH
Plasmid#83808PurposeExpress Sg-1 sgRNA targeting GAPDHDepositorInsertSgRNA
UseCRISPRAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX459-Dvl1/3 gRNA
Plasmid#246555PurposeCRISPR vector co-expressing Cas9 and a mouse Dvl1/3 gRNA (conserved region)DepositorInsertDvl1/3 gRNA
UseCRISPRPromoterU6Available SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
sg2.02 16x(MS2) MUC4.1
Plasmid#101154PurposegRNA with 16 MCP binding siteDepositorInsertMUC4 (MUC4 Human)
UseCRISPR and LentiviralAvailable SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
DKC1 F1.3 gRNA
Plasmid#90652Purpose3rd generation lentiviral gRNA plasmid targeting human DKC1DepositorInsertDKC1 (Guide Designation F1.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
DKC1 F2.3 gRNA
Plasmid#90653Purpose3rd generation lentiviral gRNA plasmid targeting human DKC1DepositorInsertDKC1 (Guide Designation F2.3)
UseCRISPR and LentiviralPromoterU6Available SinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
Cas9-GFP_sg_mAMPKa2
Plasmid#79005PurposeExpresses WT Cas9 and GFP, along with a sgRNA to mouse AMPK alpha 2.DepositorAvailable SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
BRCA1 A10.2 gRNA
Plasmid#90549Purpose3rd generation lentiviral gRNA plasmid targeting human BRCA1DepositorInsertBRCA1 (Guide Designation A10.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
gRNA-ura-HYB
Plasmid#64330Purposeura3 deletion gRNA cassette carried by pRS42HDepositorInsertgBlock product of ura3 deletion gRNA cassette
ExpressionYeastAvailable SinceApril 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
BRCA2 A11.2 gRNA
Plasmid#90550Purpose3rd generation lentiviral gRNA plasmid targeting human BRCA2DepositorInsertBRCA2 (Guide Designation A11.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only