We narrowed to 49,511 results for: prot
-
Plasmid#175468PurposeProtein expression in bacterial cells. FERM domain, M1-E346. Contains L281R point mutation that reduces binding to CD44.DepositorAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only
-
MSNA-c001
Plasmid#175466PurposeProtein expression in bacterial cells. FERM domain, M1-E346. Used for crystallography (PDB:6TXQ).DepositorAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV Myc-emerin
Plasmid#175101PurposeLentiviral expression of Myc-tagged mouse EmdDepositorAvailable SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
EGFP-uTEV1-MAVS-mTA6
Plasmid#171004PurposeHiLITR protease with MAVS [Y536delinsFIVLI, R537A, R538A] C-terminal tmd targeting information (Mitochondria)DepositorInsertEGFP-uTEV1-MAVS(tmd)[Y536delinsFIVLI, R537A, R538A]
UseLentiviral and Synthetic BiologyExpressionMammalianMutationMAVS(tmd)[Y536delinsFIVLI, R537A, R538A]PromoterpTRE-tight (TetOn)Available SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
human TLNRD1-4H pET151
Plasmid#159386PurposeExpresses human TLNRD1 4-helix domain (residues 143-273) in bacterial cellsDepositorInsertTalin Rod Domain Containing Protein 1 (TLNRD1 Human)
Tagshis-tag, TEV cleavage siteExpressionBacterialMutationTLNRD1 4-helix domain (residues 143-273)PromoterT7Available SinceJuly 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA s3
Plasmid#132395PurposeTargets AAVS1 intron 1, gRNA: GGGGCCACTAGGGACAGGAT, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBEST-p70a-UTR1-Nterm 6xHis PL K16TAG-T500
Plasmid#92315PurposeExpression of NTerm 6xHis tagged protein L (PL) mutant K16TAG for ncAA incoporation using the p70a promoter and UTR1DepositorInsertB1 domain of protein L (PL) mutant K16TAG
UseSynthetic Biology; Cell free protein synthesis (c…Tags6xHisExpressionBacterialPromoterp70b (p70a promoter with one mutation)Available SinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
KLHL31 pgk (1088)
Plasmid#62031Purposemammalian expression of nuclear envelope transmembrane proteinDepositorAvailable SinceAug. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pOUPc-Rh159-HA
Plasmid#179344PurposeAll-in-on "tet-on" 3G lentiviral vector plasmid encoding rhesus cytomegalovirus Rh159 (NK cell evasion protein) with a C-terminal HA tag fused to its cytoplasmic tailDepositorInsertRh159
UseLentiviral; All in one tet-on lentiviral vector (…TagsHA tagExpressionMammalianPromotertet responsive element 3GAvailabilityAcademic Institutions and Nonprofits only -
pOTTC588 - pAAV c-fos Nuc-iRFP
Plasmid#59132PurposeAn AAV vector that expresses nuclear localized iRFP under control of the c-fos promoter.DepositorInsertNuclear-localized Infrared Fluorescent Protein
UseAAVTags3xNLSExpressionMammalianPromotermFosAvailable SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-ALK3 K261R
Plasmid#80875Purposemammalian expression of ALK3 K261RDepositorInsertALK3 (BMPR1A Human)
TagsHAExpressionMammalianMutationK261R (Kinase inactive)PromoterCMVAvailable SinceOct. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-GFP11-Clathrin light chain
Plasmid#70217PurposeExpresses GFP11-clathrin light chain in mammalian cellsDepositorAvailable SinceMarch 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
EGFP-p65
Plasmid#111190Purposefluorescent fusion proteinDepositorAvailable SinceSept. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-SARS2-S-D614 (C-flag)
Plasmid#156420PurposeMammalian expression of SARS-CoV-2 S protein (D614) with the flag tag at C-terminus. Pseudotypes onto the MLV vector but not efficiently to VSV or lentiviral vectors.DepositorAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKK-BiFC-Venus
Plasmid#105804PurposeConcomitant expression of two proteins in fusion with fragments of Venus protein. Protein interactions studies by bimolecular fluorescence complementation (BiFC), including BiFC-FRET assays.DepositorTypeEmpty backboneUseFlp-in competentTagsVN173 (I152L); VC155ExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-SARS-CoV-2-S-RBD-sfGFP
Plasmid#141184PurposeMammalian expression plasmid for RBD of SARS-CoV-2 protein S (spike) fused with sfGFPDepositorHas ServiceCloning Grade DNAInsertS surface glycoprotein [ Severe acute respiratory syndrome coronavirus 2 ] (S SARS coronavirus 2)
TagsSignal peptide from influenza HA and Superfolder …ExpressionMammalianPromoterCMVAvailable SinceApril 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-SARS-CoV-2-S-RBD-8his
Plasmid#145145PurposeMammalian expression plasmid for RBD of SARS-CoV-2 protein S (spike) with 8his tagDepositorInsertSecreted receptor binding domain (RBD; a.a. 333-529) of S protein from SARS-CoV-2 (S SARS coronavirus 2)
Tags8his tagExpressionMammalianMutationCodon-optimized for human cell expression.PromoterCMVAvailable SinceApril 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-SARS-CoV-2-S-RBD-Fc
Plasmid#141183PurposeMammalian expression plasmid for RBD of SARS-CoV-2 protein S (spike) fused with IgG1-FcDepositorInsertSecreted receptor binding domain (RBD; a.a. 333-529) of S protein from SARS-CoV-2 fused to Fc of IgG1 (S SARS coronavirus 2)
TagsFc region of IgG1 (a.a. Asp-221 to Lys-447) and S…ExpressionMammalianPromoterCMVAvailable SinceApril 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKK-MBP-TEV
Plasmid#105771PurposeExpression of your protein of interest in fusion with MBP at the N-terminus (cleavable by TEV). The maltose binding protein tag allows convenient purification of proteins (PMID: 22442034, 19935684).DepositorTypeEmpty backboneUseFlp-in competentTagsMBP-TEVExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only