We narrowed to 15,530 results for: nsf
-
Plasmid#58841PurposeAAV expression of CsChR-GFP under the Syn promoterDepositorInsertCsChR-GFP
UseAAVTagsGFPExpressionMammalianPromoterSynAvailable SinceAug. 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
pOTTC814 - pAAV-SYN1-CRTsigpep-GCaMP3 (D324G+D360G+397G+D435G 10.19)-KDEL
Plasmid#63887PurposeAn AAV packaging vector that expresses ER-retained low-affinity GCaMP3 variant under control of the SYN1 promoter.DepositorInsertER-localized low-affinity GCaMP3(10.19)
UseAAVPromoterhuman SYN1Available SinceDec. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb HR donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97309PurposeHR donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb HR donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV2_hSyn_Phobos_Citrine
Plasmid#98216PurposeBlue-shifted artificial anion conducting channelrhodopsin (aACR). Activation max 466 nm; off-kinetics 10 ms. Codon optimized for mammalian expression.DepositorInsertSynthetic construct Phobos gene
UseAAVTagsCitrineExpressionMammalianMutationT59S, E83N, E90Q, E101S, V117R, E123S, T159G, G16…Promoterhuman synapsinAvailable SinceAug. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEMS2112
Plasmid#49137PurposeAAV plasmid with NR2E1 (Ple264) promoter driving expression of EmGFP.DepositorInsertssAAV-Ple264-emGFP
UseAAVExpressionMammalianPromoterNR2E1Available SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-hGRM1-RFP
Plasmid#22920DepositorInserthuman receptor metabotropic 1 promoter driving DsRedExpress (GRM1 Human)
UseAAVExpressionMammalianAvailable SinceMay 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mA93-RFP
Plasmid#22918DepositorInsertmouse riken gene A930038C07Rik promoter driving DsRedExpress (A930038C07Rik Mouse)
UseAAVExpressionMammalianAvailable SinceAug. 26, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLgw EcoDam-V5-SRF
Plasmid#98602PurposeMammalian DamID lentiviral vector forSRF with Dam-V5 using Gateway cloningDepositorInsertSRF (Srf Mouse)
UseLentiviral; DamidTagsDam (DNA adenine methyltransferase) and V5ExpressionMammalianPromoterHeat Shock Minimal PromoterAvailable SinceJuly 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV2_hSyn_Aurora_Citrine
Plasmid#98217PurposeRed-shifted artificial anion conducting channelrhodopsin (aACR). Activation up to 600 nm; off-kinetics 260 ms. Codon optimized for mammalian expression.DepositorInsertSynthetic construct Aurora gene
UseAAVTagsCitrineExpressionMammalianMutationV59S, E83N, E90Q, E101S, V117R, E123S, P242R, A24…Promoterhuman synapsinAvailable SinceAug. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
Pf92-bio
Plasmid#47728PurposeExpresses enzymatically monobiotinylated full-length Pf92 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised Pf92
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb NHEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97310PurposeNHEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb NHEJ donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEMS1990
Plasmid#49121PurposeAAV plasmid with FEV (Ple67) promoter driving expression of iCre.DepositorInsertssAAV-Ple67-iCre
UseAAVExpressionMammalianPromoterFEVAvailable SinceMay 6, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCS2+ cMyc-oDam_f_GFPoNLS
Plasmid#85818PurposeiDamID plasmid. To express transiently the c-Myc-tagged and optimized E. coli Dam adenine methyltransferase fused to the nuclear-localized mmGFP via flexylinker.DepositorInsertcMyc oDam_f_GFPoNLS
TagscMyc and oNLS (optimized nuclear localization sig…ExpressionBacterial, Insect, Mammalia…MutationL122A. Codon optimization compatible to work in M…Available SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBrain-GFP-TACC3KDP(S558A)-shTACC3
Plasmid#59357PurposeExpresses GFP-tagged human TACC3 (RNAi-resistant) with S558A substitution and knocks down endogenous TACC3 via shRNA.DepositorInsertTransforming Acidic Coiled Coil protein 3 (TACC3 Human)
UseRNAiTagsGFPExpressionMammalianMutationSilent mutations in amino acids 30-33 to confer s…PromoterCMVAvailable SinceDec. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEMS2116
Plasmid#49141PurposeThe plasmid contains the Pleaides (Ple) MiniPromoter Ple155 derived from the human PCP2 gene and designed for expression in ON Bipolar cells of the retina.DepositorInsertssAAV-Ple155-emGFP
UseAAVExpressionMammalianPromoterMiniPromoter Ple155 from the human PCP2 geneAvailable SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1981
Plasmid#49112PurposeAAV plasmid with NR2E1 (Ple264) promoter driving expression of iCre.DepositorInsertssAAV-Ple264-iCre
UseAAVExpressionMammalianPromoterNR2E1Available SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
RCAS-sgATG7
Plasmid#75228PurposeAn adaption on the RCAS/tv-a somatic cell gene transfer system, for use in combination with an existing Cas9 background in the cell/mouse of interest. Depositors: Jane Fraser/Noor GammohDepositorAvailable SinceJune 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
FUW TetO NET1A-V5 WT
Plasmid#69828PurposeExpresses NET1A-V5 in mammalian cells in a doxycycline inducible mannerDepositorInsertNeuroepithelial cell-transforming gene 1 protein A (NET1 Human)
UseLentiviralTagsv5ExpressionMammalianPromoterminimal CMV promoter with tetracycline operatorAvailable SinceApril 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV_3xgRNA;PTENA, p53B,SMAD4A_CAG_FlPO_synthPA
Plasmid#68346PurposeUsed to produce AAV expressing the FlpO recombinase and pig gRNA towards 3 tumor suppressors: PTEN, p53 and SMAD4DepositorInserts3xgRNA;PTENA, p53B,SMAD4A
FlPO
UseAAV; Flp/frtExpressionMammalianPromoterCAG and U6Available SinceDec. 2, 2015AvailabilityAcademic Institutions and Nonprofits only