We narrowed to 9,772 results for: Tec
-
Plasmid#44576DepositorUseRetroviralTagsMycExpressionMammalianMutationTRF1 containing the iDDR domain of TRF2 (aa407-43…Available SinceMay 31, 2013AvailabilityAcademic Institutions and Nonprofits only
-
pEGFP-C1-PRKAA2ΔC
Plasmid#30307DepositorInsertAMP-activated Protein Kinase α2 ΔC (Prkaa1 Rat)
TagsGFPExpressionMammalianMutationdeleted amino acids Ser 527 to Arg 552Available SinceAug. 23, 2011AvailabilityAcademic Institutions and Nonprofits only -
ATF4 12: 5’ATF4.uORF1AUA.GFP
Plasmid#21859DepositorInsertATF4 (Atf4 Mouse)
TagsEGFPExpressionMammalianMutationAUG codon of uORF1 was converted to AUAAvailable SinceSept. 10, 2009AvailabilityAcademic Institutions and Nonprofits only -
pU1utr-EGFP
Plasmid#140268PurposeU1A-dependent translational repressionDepositorInsertU1A binding site
UseSynthetic BiologyExpressionMammalianPromoterCMVAvailable SinceOct. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
plet7d_stbC-EGFP
Plasmid#140266PurposeLIN28-dependent translational repressionDepositorInsertStabilized hairpin of miR-let7d
UseSynthetic BiologyExpressionMammalianPromoterCMVAvailable SinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLNHA-C1-Hs4E-BP3
Plasmid#79439PurposeExpresses lambdaN-HA-tagged human 4E-BP3 in Mammalian cellsDepositorAvailable SinceJuly 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
LLP777_SnoopCatcher-p65HSF1-CO
Plasmid#211770PurposeSnoopTag counterpart binding domain, SnoopCatcher, fused to transcriptional activator p65HSF1, with GFP selectionDepositorInsertSnoopCatcher-p65HSF1
Tags2xOLLASExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect p65HSF…PromoterpEF1a and pSV40Available SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
mcherry-p62 delta PB1 silent
Plasmid#187985Purposehuman p62 lacking PB1 domain (=aa1-102) with a silent mutation to get resistance for sip62 #5 (Dharmacon). Internal Reference: SMC552DepositorInsertp62 (NUP62 Human)
TagsmCherryExpressionMammalianMutationLacking PB1 domain (aa1-102) with a silent mutati…Available SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-EGFP-eDHFR(69K6)-MCS
Plasmid#172100PurposeMammalian expression of a protein of interest fused to the C-terminus of EGFP-eDHFR(69K6)DepositorInsertEGFP-eDHFR(69K6)-20aa
ExpressionMammalianMutationeDHFR(69K6): Hexalysine (K6) sequence is inserted…PromoterCMVAvailable SinceJuly 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-mHP1beta
Plasmid#181901PurposeFluorescently tagged HP1betaDepositorAvailable SinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-Tollip M240A,F241A
Plasmid#178051PurposeGFP fused to human Tollip cDNA carrying mutations in the CUE domain. Localisation and expression in mammalian cells.DepositorInsertToll-Interacting Protein (TOLLIP Human)
TagsGFPExpressionMammalianMutationChanged Methionine 240 to Alanine and changed Phe…PromoterCMVAvailable SinceDec. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCIBN-TetR
Plasmid#103813PurposeBLInCR 'Localizer' construct that marks tetO arrays and is targeted by a PHR-tagged effector upon illumination with blue lightDepositorExpressionMammalianMutationTetR: A4G (M2V)PromoterCMVAvailable SinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C3-PLK4-K41M-S285A-T289A-3xFLAG
Plasmid#69842PurposeThis plasmid encodes kinase dead PLK4 isoform 1 carrying K41M and S285A/T289A mutations with an N-terminal EGFP tag and C-terminal 3xFLAG tagDepositorInsertPLK4 (PLK4 Human)
Tags3xFLAG tag and EGFPExpressionMammalianMutationK41M-S285A-T289APromoterCMVAvailable SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL14-GFP
Plasmid#67406PurposeMammalian expression of hArl14 with C-term GFP tagDepositorInsertARL14 (ARL14 Human)
TagsGFPExpressionMammalianMutationbp 172 C to T; aa L58FPromoterCMVAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pT7-agrBD-IV
Plasmid#53440PurposeDerivative of pT7-agrBD-I with a point mutation in the agrD gene to change AIP coding region from type-I to type-IVDepositorInsertagrBD locus (with D29Y mutation in agrD)
UseSynthetic BiologyTagsV5 epitope, 6x HIS (not expressed on agrB or agrD…ExpressionBacterialMutationD to Y mutation of residue 29 of the agrD gene (c…PromoterT7-lacAvailable SinceJune 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pTRCHisB-TRF2∆M
Plasmid#50489PurposeE. Coli N-term HexHis Tagged Protein Expression VectorDepositorInsertTRF2 Delta Myb (TERF2 Human)
Tags6x His, T7 tag, and TEV protease siteExpressionBacterialMutationContains amino acids 3-437PromoterpTrcAvailable SinceFeb. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pTRCHisB-TRF2_M
Plasmid#50490PurposeE. Coli N-term HexHis Tagged Protein Expression VectorDepositorInsertTRF2 Myb (TERF2 Human)
Tags6x His, T7 tag, and TEV protease siteExpressionBacterialMutationContains amino acids 438-500PromoterpTrcAvailable SinceFeb. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBabe-Myc-TRFcH
Plasmid#44574DepositorUseRetroviralTagsMycExpressionMammalianMutationTRF2 Hinge domain (aa245-443) replaced by that of…Available SinceMay 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-CD86-mApple
Plasmid#133860PurposeMammalian expression of CD86 N-terminally tagged with EGFP and C-terminally tagged with mAppleDepositorAvailable SinceNov. 8, 2019AvailabilityAcademic Institutions and Nonprofits only