-
Plasmid#74513PurposeAAV vector that use human synapsin-1 promoter to drive the expression of EGFP and membrane-targeted EGFPf linked by self-cleaving P2A peptide.DepositorInsertEGFP-p2A-EGFP-f
UseAAVTagsExpressionMutationPromoterAvailable sinceJuly 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Hbb
Plasmid#99692PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Hbb, vector allows for strong activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (Hbb Synthetic)
UseAAVTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-ChroME-ST-P2A-H2B-mRuby3
Plasmid#108912PurposeCation channelrhodopsin ChroME targeted to the neuronal soma and proximal dendrites and separated from nuclear mRuby3 by P2A in a viral vectorDepositorHas ServiceAAV9InsertChroME-ST
UseAAVTagsExpressionMutationPromoterCAGAvailable sinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2ExpressionMutationPromoterEF1a, hU6, and mU6Available sinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-ASAP3-WPRE
Plasmid#132318Purposeexpresses ASAP3(ASAP-family genetically encoded voltage indicator) in cre recombinase expressing mouse/cell, gene delivered by pAAV-EF1a vectorDepositorInsertASAP3
UseAAV and Cre/LoxTagsExpressionMammalianMutationPromoterEF1aAvailable sinceDec. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS3-TeTLc-P2A-mCherry
Plasmid#178708PurposeAAV vector for Flp-dependent transgene expression of TeTLc-P2A-mCherry in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertTeTLc-P2A-mCherry
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hsyn_NES-his-CaMPARI2-L398T-WPRE-SV40
Plasmid#101064PurposeAAV vector expressing CaMPARI2_L398T (Kd = 825nM), a photoconvertible fluorescent protein-based calcium integrator, in neuronsDepositorHas ServiceAAV1InsertCaMPARI2_L398T
UseAAVTagsFLAG-HA-myc and NES_hisExpressionMutationPromoterhsyn (synapsin-1)Available sinceOct. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hsyn_NES-his-CaMPARI2-F391W-WPRE-SV40
Plasmid#101061PurposeAAV vector expressing CaMPARI2_F391W (Kd = 110nM), a photoconvertible fluorescent protein-based calcium integrator, in neuronsDepositorHas ServiceAAV1InsertCaMPARI2-F391W
UseAAVTagsFLAG-HA-myc and NES_hisExpressionMutationPromoterhsyn (synapsin-1)Available sinceOct. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEJS-HZ100 AAV-SpABE8e-C_terminus-tracrRNA
Plasmid#211818PurposeAAV vector expressing C-terminus of SpCas9-ABE8e with tracrRNADepositorInsertC-terminus of SpCas9-ABE8e and tracrRNA
UseAAVTagsExpressionMammalianMutationPromoterchicken β-actin promoter and U6 promoterAvailable sinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hsyn_NES-his-CaMPARI2-H396K-WPRE-SV40
Plasmid#101062PurposeAAV vector expressing CaMPARI2_H396K (Kd = 360nM), a photoconvertible fluorescent protein-based calcium integrator, in neuronsDepositorInsertCaMPARI2-H396K
UseAAVTagsFLAG-HA-myc and NES_hisExpressionMutationPromoterhsyn (synapsin-1)Available sinceOct. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pOTTC946 - pAAV CMV-IE NK1R-IRES-EGFP
Plasmid#102935PurposeAn AAV vector that expresses rat NK1R-IRES-EGFP under the CMV-IE promoterDepositorInsertNK1R (Tacr1 Rat)
UseAAVTagsExpressionMammalianMutationPromoterCMV-IEAvailable sinceSept. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(AAVS1)-hU6gRNA5(BbsI)-PGKpuroBFP-W
Plasmid#200502PurposeLentiviral vector expressing gRNA targeting human AAVS1DepositorInsertAAVS1 (AAVS1 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1663 - pAAV SYN1 mGas6-Myc-DDK
Plasmid#202540PurposeAn adeno-associated viral vector expressing murine Gas6 fused Myc and DDK epitopes from a synapsin promoterDepositorInsertGas6 (Gas6 Mouse)
UseAAVTagsMyc-DDKExpressionMutationPromoterSYN1Available sinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV2ss-EFS-GFP-synPolyA-U6-sgHTT1-U6-sgCas9
Plasmid#190903PurposeAAV-KamiCas9 vector expressing expressing thew GFP reporter gene and sgHTT and sgCas9DepositorInsertGFP, sgHTT and sgCas9 (HTT Human)
UseAAV and CRISPRTagsExpressionMutationPromoterEFS and U6Available sinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1706 - pAAV mGrid1 390F gRNA EF1a EGFP-KASH
Plasmid#131683PurposeAn adeno-associated viral vector expressing nuclear envelope-embedded eGFP and a guide RNA for mGrid1DepositorInsertsEGFP-KASH
SpCas9 sgRNA vs mouse GRID1
UseAAVTagsKASHExpressionMutationPromoterEF1a and mU6Available sinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-ChroME2s-ST-P2A-H2B-mRuby3
Plasmid#170163PurposeCation channelrhodopsin ChroME2s targeted to the neuronal soma and proximal dendrites and separated from nuclear mRuby3 by P2A in a viral vectorDepositorInsertChroME2s-P2A-H2B-mRuby3
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-GCaMP 6m-p2A-ChRmine-Kv2.1-WPRE
Plasmid#131003Purposebicistronic AAV vector to express GCaMP6m and soma-targeted ChRmine under the control of CamKIIa promoterDepositorInsertChRmine
UseAAVTagsKv2.1-HAExpressionMutationPromoterCaMKIIaAvailable sinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-ChroME2f-ST-P2A-H2B-mRuby3
Plasmid#171150PurposeCation channelrhodopsin ChroME2f targeted to the neuronal soma and proximal dendrites and separated from nuclear mRuby3 by P2A in a viral vectorDepositorInsertChroME2f-P2A-H2B-mRuby3
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO {hCAR}off-{ChETA}on-WPRE
Plasmid#111388PurposeAAV vector with hSynapsin promoter, Cre-OFF hCAR (for efficient CAV-2 infection) and Cre-ON ChETA (for optogenetic activation)DepositorInsertsUseAAVTagsHA and MycExpressionMammalianMutationPromoterhSynapsinAvailable sinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-NLS-mRuby3-IRES-eGtACR1-ST
Plasmid#109048PurposeAnion channelrhodopsin GtACR1 fused to ER export signal and targeted to the neuronal soma and proximal dendrites under the control of internal ribosome entry sequence in a viral vectorDepositorHas ServiceAAV9InserteGtACR1-ST
UseAAVTagsExpressionMutationPromoterCAGAvailable sinceJuly 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-ChroME-ST-P2A-H2B-mRuby3
Plasmid#170161PurposeCation channelrhodopsin ChroME targeted to the neuronal soma and proximal dendrites and separated from nuclear mRuby3 by P2A in a viral vectorDepositorInsertChroME-P2A-H2B-mRuby3
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO {mCAR}off-{GCaMP6f}on-WPRE
Plasmid#111393PurposeAAV vector with hSynapsin promoter, Cre-OFF mCAR (for efficient CAV-2 infection) and Cre-ON GCaMP6f (ultrasensitive calcium sensor)DepositorInsertsUseAAVTags6xHis, Myc, T7, and XpressExpressionMammalianMutationPromoterhSynapsinAvailable sinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO {mCAR}off-{ChETA}on-WPRE
Plasmid#111387PurposeAAV vector with hSynapsin promoter, Cre-OFF mCAR (for efficient CAV-2 infection) and Cre-ON ChETA (for optogenetic activation)DepositorInsertsUseAAVTagsHA and MycExpressionMammalianMutationPromoterhSynapsinAvailable sinceJune 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-RSV-GFP-U6-Rosa26 gRNA (SpyCas9 scaffold)
Plasmid#120296PurposeAAV vector; encodes GFP as well as a U6-driven Rosa26-targeting gRNA (SpyCas9 scaffold)DepositorInsertRosa26 gRNA (SpCas9 scaffold)
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJan. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1619 pAAV SYN1 Nuc-EYFP miR-30 SST
Plasmid#135565PurposeAn AAV vector expressing miR-30a shRNA vs rat SOM (aka SST) and a nuclear EYFP reporterDepositorInsertsmiR-30 rat SST
Nuc-EYFP
UseAAVTags3xNLSExpressionMammalianMutationPromoterSYN1 and hSYN1Available sinceSept. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1618 pAAV SYN1 Nuc-EYFP miR-30 FF3
Plasmid#135564PurposeAn AAV vector expressing miR-30a shRNA vs FF luciferase and a nuclear EYFP reporterDepositorInsertsmiR-30 FF3
Nuc-EYFP
UseAAVTags3xNLSExpressionMammalianMutationPromoterSYN1 and hSYN1Available sinceSept. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Tet-Off-FLEX-DEST (JDW 1186)
Plasmid#229820PurposeAn AAV, tet-off, gateway compatible destination vector with cre dependent expression of the insert. EFS driving destablized rTADepositorTypeEmpty backboneUseAAVTagsExpressionMutationPromoterAvailable sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV CMV-driven AcrIIA4-2xmiR-1 target sites
Plasmid#120299PurposeAAV vector for expression of AcrIIA4 with two miR-1 binding sitesDepositorInsertAcrIIA4-2xmiR-1 binding sites
UseAAV and CRISPRTagsFLAGExpressionMammalianMutationPromoterAvailable sinceJan. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-JEDI-2P-WPRE
Plasmid#179469PurposeGenetically encoded voltage indicator (GEVI) JEDI-2P in AAV production vector for astrocytes specific expression using the promoter GFAPDepositorInsertJEDI-2P
UseAAVTagsExpressionMammalianMutationPromoterGFAPAvailable sinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-JEDI-2P-WPRE
Plasmid#179466PurposeGenetically encoded voltage indicator (GEVI) JEDI-2P in AAV production vector for expression in excitatory glutamatergic neurons using the promoter CaMKIIDepositorInsertJEDI-2P
UseAAVTagsExpressionMammalianMutationPromoterCaMKIIaAvailable sinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
AiP11851-pAAV-hDLX-minBG-iCre-4X2C-WPRE3-BGHpA (Alias: CN1851)
Plasmid#164450PurposeAAV vector for Cre expression in forebrain GABAergic interneurons. For use in combination with Cre-dependent transgenic mouse lines or co-infection with Cre dependent viral vectors.Has ServiceAAV PHP.eBInsertiCre
UseAAVTagsExpressionMutationPromoterminBetaGlobinAvailable sinceFeb. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-Flex-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA
Plasmid#68717PurposeCre-dependent bicistronic vector expressing mRuby2 and GCaMP6s from a single open reading frame.DepositorHas ServiceAAV1InsertmRuby2-P2A-GCaMP6s
UseAAVTagsExpressionMutationCre-dependent expression from inverted open readi…PromoterCAG-FLEXAvailable sinceJune 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-Flex-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA
Plasmid#68720PurposeCre-dependent bicistronic vector expressing mRuby2 and GCaMP6s from a single open reading frame.DepositorHas ServiceAAV1InsertmRuby2-P2A-GCaMP6s
UseAAVTagsExpressionMutationCre-dependent expression from inverted open readi…PromoterhSyn1-FLEXAvailable sinceJune 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV CMV-driven AcrIIC1-2xmiR-122 target sites
Plasmid#120302PurposeAAV vector for expression of AcrIIC1 with two miR-122 binding sitesDepositorInsertAcrIIC1-2xmiR-122 binding sites
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV CMV-driven AcrIIC3-2xmiR-122 target sites
Plasmid#120303PurposeAAV vector for expression of AcrIIC3 with two miR-122 binding sitesDepositorInsertAcrIIC3-2xmiR-122 binding sites
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV9:cTNT::3Flag-hYAP S127A
Plasmid#86558PurposeTo produce cardiac specific adeno-associated virus expressing activated human YAP.DepositorInsertYAP (YAP1 Human)
UseAAVTags3FlagExpressionMutationSerine 127 was mutated into Alanine, to activate …PromotercTNTAvailable sinceFeb. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV_U6-ωRNA*_ISDra2-TnpB-mNG
Plasmid#212968PurposeAAV vector for encoding an ISDra2-TnpB driven by EFs promoterDepositorInsertsISDra2-TnpB-T2A-mNG,
ωRNA*
UseAAV and CRISPRTagsNLS and NLS-FLAGExpressionMammalianMutationPromoterEF1a, T7 and U6Available sinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-ASAP3Kv-WPRE
Plasmid#132330Purposeexpresses ASAP3Kv(soma-located version of ASAP3, ASAP-family genetically encoded voltage indicator) in cre recombinase expressing mouse/cell, gene delivered by pAAV-EF1a vectorDepositorInsertASAP3KV
UseAAV and Cre/LoxTagsExpressionMammalianMutationPromoterEF1aAvailable sinceDec. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO-PPO-Venus
Plasmid#139505PurposeAAV vector for Cre-dependent expression of Venus-tagged parapinopsin driven by the Ef1a promoter. Used for photoswitchable control of inhibitory GPCR signaling cascades.DepositorHas ServiceAAV8 and AAV9Insertparapinopsin
UseAAVTagsVenus tag following 3x Ala linkerExpressionMammalianMutationPromoterEf1aAvailable sinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-PPO-Venus
Plasmid#139504PurposeAAV vector for Cre-dependent expression of Venus-tagged parapinopsin driven by the CAG promoter. Used for photoswitchable control of inhibitory GPCR signaling cascades.DepositorHas ServiceAAV5Insertparapinopsin
UseAAVTagsVenus tag following 3x Ala linkerExpressionMammalianMutationPromoterCAGAvailable sinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only