We narrowed to 1,566 results for: aav vector plasmid
-
Plasmid#178706PurposeAAV vector for transgene expression of hChR2-tBFP in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInserthChR2-tBFP
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-TRE-NS1-dTomato
Plasmid#175278PurposeAAV vector mediating inducible bicistronic expression of NS1 gene of YFV-17D and dTomatoDepositorInsertNS1; dTomato (POLY Yellow fever virus strain 17D)
UseAAVTagsdTomato (from bidirectional promoter)Promoterbidirectional TRE promoterAvailable SinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hSyn_HA-TALE(NG)-Tet1FL-NLS_2A_EGFP_W3SL
Plasmid#172195PurposeAAV sequence-specific control vector for TALE-Tet1FL-SID4X. Synapsin promoter for neuronal expression. C-terminal, self-cleaving EGFP marker.DepositorInsertHA-TALE(NG)-Tet1FL-NLS_2A_EGFP_W3SL
UseAAV and Mouse Targeting; TaleTagsHA, NLS, and T2A-EGFPExpressionMammalianMutationtranscription regulatory domain removedPromoterhSyn human synapsin (mammalian neuronal expressio…Available SinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgRNA-EF1a-LibVec
Plasmid#239591PurposeAAV vector for cloning and expression of sgRNAs - concomitant expression of GFP serves as transfection markerDepositorTypeEmpty backboneUseAAVExpressionMammalianPromoterhU6Available SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.RMacL3-01.ChR2(H134R)-GFP.BCC10
Plasmid#229639PurposeL3 pyramidal neuron Enhancer to drive transgene expressionDepositorInsertRMacL3-01.ChR2(H134R)-GFP.BCC10
UseAAVExpressionMammalianAvailable SinceJune 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAVss-U6-sgHTT51-7sk-Cas9
Plasmid#190901PurposeAAV-KamiCas9 vector expressing sgGFP and mouse HTT sgRNADepositorAvailable SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-UbC-3xNLS-mScarlet-I
Plasmid#191099PurposeTo express a bright monomeric red FP to label eucaryotic cell nuclei. To be used in tissue clearing methods and other fluorescent microscopy methodsDepositorInsert3xNLS-mScarlet-I
UseAAV and Synthetic BiologyTagsThree repeats of the nuclear localizzation seque…ExpressionMammalianMutationoptimized to human codon usagePromoterUbCAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS2-V5-APEX2-NES
Plasmid#178702PurposeAAV vector for Cre-dependent transgene expression of V5-APEX2-NES in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertV5-APEX2-NES
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS3-V5-APEX2-NES
Plasmid#178703PurposeAAV vector for Flp-dependent transgene expression of V5-APEX2-NES in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertV5-APEX2-NES
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hSyn_HA-TALE(HD)-Tet1S-NLS_2A_EGFP_W3SL
Plasmid#172200PurposeAAV sequence-specific control vector for TALE-Tet1S-SID4X. Synapsin promoter for neuronal expression. C-terminal, self-cleaving EGFP marker.DepositorInsertHA-TALE(HD)-Tet1S-NLS_2A_EGFP_W3SL
UseAAV and Mouse Targeting; TaleTagsHA, NLS, and T2A-EGFPExpressionMammalianMutationtranscription regulatory domain removedPromoterhSyn human synapsin (mammalian neuronal expressio…Available SinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pM155: pAAV.CMV-Cas13e (GenScript CO)-NT sgRNA
Plasmid#203451PurposePlasmid expressing active and codon optimised Cas13e with non-targeting gRNADepositorInsertsU6-non targeting (NT) sgRNA
Cas13e
UseAAVTagsHA and NLSExpressionMammalianMutationCodon optimised using GenScript toolPromoterCMV and U6Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Htt171-66Q-myc-WPRE
Plasmid#107934PurposeAdeno-Associated viral (AAV) vector plasmid expressing exon1 of mutant HTT (mHTT, 66 polyQ repeats) in neuronsDepositorAvailable SinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Htt171-18Q-myc-WPRE
Plasmid#107936PurposeAdeno-Associated viral (AAV) vector plasmid expressing exon1 of wild type HTT (wtHTT, 18 polyQ repeats) in neuronsDepositorAvailable SinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-NES-jRGECO1a-WPRE
Plasmid#216276PurposeAAV vector with hSynapsin promoter and DIO Lox sites for Cre-On expression of red fluorescent calcium indicator jRGECO1aDepositorInsertNES-jRGECO1a
UseAAV and Cre/LoxTags6XHIS and XpressPromoterhuman synapsin 1 (hSyn)Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-Hsp1-Hsp2Cas9-KY-P2A-puro
Plasmid#192133PurposeExpresses highly specific Hsp1-Hsp2Cas9, cloning backbone for sgRNA and puromycin resistance geneDepositorInsertHsp1-Hsp2Cas9-KY
UseAAVExpressionMammalianMutationHsp1-Hsp2Cas9 (K390A, Y446A)Available SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEXFRT-ChR2(H134R)-mCherry
Plasmid#75470PurposeFlp-dependent Chr2-mCherry encoded in an AAV vector for rAAV production and expression in mammalian cellsDepositorHas ServiceAAV1InsertReversed ChR2(H134R)-mCherry
UseAAV and Synthetic BiologyExpressionMammalianPromoterCAGAvailable SinceJuly 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TIWB-myrmScarlet-I-P2A-post-eGRASP
Plasmid#111584PurposeAn AAV vector that expresses myristoylated mScarlet-I and post-eGRASP linked by self-cleaving P2A peptide under the tetO promoter.DepositorInsertmyrmScarlet-I-P2A-post-eGRASP
UseAAVPromotertetOAvailable SinceJune 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCAG eGFP T2A SP HALO HAPLN1
Plasmid#228200PurposeAAV vector expressing GFP and HaloTag-HAPLN1 under constitutive promoterDepositorAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TIWB-myrTagRFP-T-P2A-post-eGRASP
Plasmid#111590PurposeAn AAV vector that expresses myristoylated TagRFP-T and post-eGRASP linked by self-cleaving P2A peptide under the tetO promoter.DepositorInsertmyrTagRFP-T-P2A-post-eGRASP
UseAAVPromotertetOAvailable SinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hGFAP-Pink Flamindo-WPRE-SV40
Plasmid#178790PurposeAAV vector to express the red cAMP indicator in astrocytesDepositorInsertPink Flamindo
UseAAVPromoterhGFAPAvailable SinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FRT-myrSNAP-2A-H2BeGFP-WPRE
Plasmid#102986PurposeAAV expressing membrane-targeted SNAP protein and nuclear-targeted eGFP after FLP-mediated recombinationDepositorInsertsmembrane-targeted SNAP protein after FLP-mediated recombination
Nuclear-targeted eGFP after FLP-mediated recombination
UseAAV; Adeno associated viral vectorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-JEDI-2Psub-WPRE
Plasmid#247224PurposeDouble floxed genetically encoded voltage indicator (GEVI) JEDI-2Psub in AAV production vector under the control of the mammalian promoter (EF1a)DepositorInsertJEDI-2Psub
UseAAV and Cre/LoxExpressionMammalianPromoterEF1aAvailable SinceOct. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-fDIO-seTurboID-IRES-tTA
Plasmid#240206PurposeAmplifier AAV vector of Dual-AAV sparse labeling system encoding seTurboIDDepositorInsertseTurboID
UseAAVTagsFLAG tagExpressionMammalianPromoterTREAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-Hsp1-Hsp2Cas9-Y-P2A-puro
Plasmid#192132PurposeExpresses highly specific Hsp1-Hsp2Cas9, cloning backbone for sgRNA and puromycin resistance geneDepositorInsertHsp1-Hsp2Cas9-Y
UseAAVExpressionMammalianMutationHsp1-Hsp2Cas9 (Y446A)Available SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-miniDi-P2A-mCherry
Plasmid#204358PurposeAAV vector for miniDi expression under the control of human synapsin promoterDepositorInsertminiDi-P2A-mCherry
UseAAVTagsmCherryMutationThe third intracellular loop (ICL3) of hM4Di was …PromoterhSynAvailable SinceOct. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6gRNA1-U6gRNA2-TnT-Cre
Plasmid#87682PurposeAAV vector for U6 driven expression of two gRNAs, and cardiomyocyte specific expression of Cre recombinase.DepositorInsertsgRNA1
gRNA2
Cre
UseAAVPromoterU6 and cTnTAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-Puro-AAVR-FLAG
Plasmid#166716PurposeVector expressing AAVR (KIAA0319L) with a C-terminal Flag tagDepositorAvailable SinceJune 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-ChRmine-mScarlet-WPRE
Plasmid#130994PurposeAAV vector to drive the expression of ChRmine-mScarlet under the control of human synapsin promoterDepositorInsertChRmine
UseAAVTagsmScarletPromoterhSynAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-miniDq-P2A-mCherry
Plasmid#204357PurposeAAV vector for miniDq expression under the control of human synapsin promoterDepositorInsertminiDq-P2A-mCherry
UseAAVTagsmCherryMutationThe third intracellular loop (ICL3) of hM3Dq was …PromoterhSynAvailable SinceOct. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-CMV-Flag-PGC1a-6His
Plasmid#67637PurposeAAV vector expressing PGC1a geneDepositorAvailable SinceApril 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-ChRmine-mScarlet-WPRE
Plasmid#130990PurposeAAV vector to drive the expression of ChRmine-mScarlet under the control of CamKIIa promoterDepositorInsertChRmine
UseAAVTagsmScarletPromoterCaMKIIaAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC385 - pAAV CMV-IE IRES EGFP
Plasmid#102936PurposeAn AAV vector that expresses IRES EGFP under the CMV-IE promoterDepositorInsertEGFP
UseAAVExpressionMammalianPromoterCMV-IEAvailable SinceSept. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-ChRmine-eYFP-WPRE
Plasmid#130988PurposeAAV vector to drive the expression of ChRmine-eYFP under the control of CamKIIa promoterDepositorInsertChRmine
UseAAVTagseYFPPromoterCaMKIIaAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MPRA-MluI-SpeI-EcoRI
Plasmid#190196PurposeEmpty vector for inserting MPRA libraries into AAVDepositorTypeEmpty backboneUseAAV; Massively parallel reporter assay (mpra)ExpressionMammalianAvailable SinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-ChRmine-eYFP-WPRE
Plasmid#130992PurposeAAV vector to drive the expression of ChRmine-eYFP under the control of human synapsin promoterDepositorInsertChRmine
UseAAVTagseYFPPromoterhSynAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV N-SpyCas9-Intein, U6-gRNA scaffold (F+E)
Plasmid#120293PurposeAAV Vector for expression of N-terminal SpyCas9 fragment with Intein and a U6-driven F+E gRNA scaffoldDepositorInsertN-terminal fragment of SpyCas9
UseAAV and CRISPRTagsSV40-NLS and split-inteinExpressionMammalianAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-PdTK-CAG-mCh-[uBglII]
Plasmid#107280Purposepuro-deltaTK gene-trap selection cassette (AAVS1 donor vector backbone) with constitutive mCherryDepositorInsertAAVS1 puro-deltaTK; CAG-mCherry (PPP1R12C )
Available SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV Syn-FLEX-coca-5HT3-IRES-mCherry
Plasmid#242195PurposeCre-dependent AAV vector for cocaine-gated chemogenetic cation channelDepositorInsertSyn-FLEX-coca-5HT3-IRES-mCherry (Htr3a Mouse)
UseAAVExpressionMammalianMutationL141G G175K Y210F Y217FPromoterSynapsinAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only