We narrowed to 23,436 results for: his
-
Plasmid#174809PurposeBacterial expression of isolated PARP1 HD subdomainDepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only
-
Sema6d.1-Fc-His
Plasmid#72168PurposeExpresses the extracellular region of the Sema6D, isoform 1 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHis-hPim1
Plasmid#100722PurposeExpression of human Pim1 kinase domain in E.coliDepositorInsertPim1 (PIM1 Human)
TagsHisExpressionBacterialMutationResidues 29-313 of isoform 2PromoterT7 promotorAvailable SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
Ncam1_1.18.1-AP-His
Plasmid#71962PurposeExpresses the extracellular region of the NCAM1, isoform 1.18.1 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMC060-HisMS2_PLP_Env_pac
Plasmid#155040PurposeGeneration of MS2 Virus Like Particles packaged with the sequence for the SARS-CoV-2 Envelope GeneDepositorInsertsMaturation Protein
Coat Protein Dimer
Envelope Gene
ExpressionBacterialMutationRemove TypeIIs Restriction SitesPromoterT7Available SinceSept. 9, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
Ncam1_0.0.0-AP-His
Plasmid#71960PurposeExpresses the extracellular region of the NCAM1, isoform 0.0.0 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema3f(L,+)-AP-His
Plasmid#72021PurposeExpresses the Sema3F protein (truncated at cleavage site P3; ie, long and contains no deletion in exon 3), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Flrt3-AP-His
Plasmid#71949PurposeExpresses the extracellular region of the FLRT3 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
Cntn2-AP-His
Plasmid#71940PurposeExpresses the extracellular region of the Contactin 2 protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema6d.1-AP-His
Plasmid#72042PurposeExpresses the extracellular region of the Sema6D, isoform 1 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHisAlix deltaPRD
Plasmid#42577DepositorInsertdelta-PRD ALIX (residues 1-702) (PDCD6IP Human)
TagsHIS-TEVExpressionBacterialMutationsilent mutation A1617G (numbering in ALIX gene)Available SinceDec. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1MycHis/HIP1/ΔE
Plasmid#31252DepositorInsertHuntingtin-interacting protein 1 (HIP1 Human)
Tagshis and mycExpressionBacterialMutationdeleted ENTH domainAvailable SinceSept. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
His10-tag
Plasmid#55179Purpose10xHis-tagDepositorInsertHis10
UseSynthetic Biology; Bacillus biobrick boxAvailable SinceJuly 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
Unc5c.a-Fc-His
Plasmid#72180PurposeExpresses the extracellular region of the Unc5C, isoform a protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceJan. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Jam1-AP-His
Plasmid#71952PurposeExpresses the extracellular region of the JAM-1 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pST50Trc4-STRHISNDHFR
Plasmid#64000PurposePosition 4 transfer plasmid for pST44 polycistronic plasmid suite; N-term cleavable double tag; contains DHFR gene in BamHI-NgoMIV cassette as positive controlDepositorTypeEmpty backboneTags6xHis & Strep II (STR); TEV cleavableExpressionBacterialPromoterT7Available SinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBS-Histone H1
Plasmid#45083DepositorInsertHistone H1
UseRNAi; In vitro transcriptionPromoterT7 sense, T3 antisenseAvailable SinceJune 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
Sema5a-AP-His
Plasmid#72035PurposeExpresses the extracellular region of the Sema5A protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema7a-AP-His
Plasmid#72049PurposeExpresses the extracellular region of the Sema7A protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only