We narrowed to 25,285 results for: crispr
-
Plasmid#85588PurposeIntegrate plasmid of Streptococcus pneumoniae, for chromosome integration of IPTG-inducible dCas9spDepositorInsertdCas9sp
UseCRISPRExpressionBacterialPromoterPLspAvailable sinceJan. 3, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
dead Sa Cas9
Plasmid#138162PurposeFor orthogonal R loop assay (use with Sp-derived base editor, Sp gRNA, and Sa gRNA for assay)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertdSaCas9
TagsNLSExpressionMammalianMutationD10A + N580APromoterCMVAvailable sinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDT-sgRNA
Plasmid#138271PurposeDual-targeting sgRNA vector that contains both a sgRNA against BFP (sgBG) and a sgRNA for a genomic target site (sgTS)DepositorInsertsgBG, sgTS
UseCRISPRExpressionMammalianAvailable sinceMarch 3, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMK392 (mAID-mClover-BSD)
Plasmid#121193PurposeC-terminal taggingDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmAID-mClover-BS
UseCRISPRAvailable sinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Click editor (CE1) - pCMV-T7-PCV2-nCas9-EcKlenow (EMK488)
Plasmid#208942PurposeThe CE1 construct, expressed from CMV or T7 promoters.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPCV2-XTEN-nSpCas9-BPNLS-EcKlenow(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A); EcKlenow(-exo;D355A/E357A)PromoterCMV and T7Available sinceNov. 22, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pFlpStop-HDR-UAS-2.1-tdTom
Plasmid#89148PurposeFlpStop plasmid for CRISPR/HDR. Has MCS for homology armsDepositorTypeEmpty backboneUseCRISPRExpressionInsectPromoter5XUAS, 3XP3-dsRedAvailable sinceApril 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMK364 (CMV-OsTIR1-loxP-PURO-loxP)
Plasmid#121184PurposeOsTIR1 introductionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCMV-OsTIR1-loxP-PURO-loxP
UseCRISPRMutationOsTIR1 codon optimized for human cellsAvailable sinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJJR83
Plasmid#75028PurposemCherry^SEC^3xFlag vector with ccdB markers for cloning homology armsDepositorInsertmCherry^SEC^3xFlag
UseCRISPRTags3xFLAG and C. elegans codon optimized mCherryExpressionWormAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDD268
Plasmid#132523PurposemNG^SEC^3xFlag vector with ccdB markers for cloning homology armsDepositorInsertmNG-C1^SEC^3xFlag
UseCRISPR and Cre/LoxTags3xFlag and C. elegans codon-optimized mNGExpressionWormAvailable sinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSpCas9(BB)-T2A-HygR
Plasmid#118153PurposeSpCas9 expression vectorDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthSpCas9-T2A-HygR
UseCRISPRTags3XFLAGExpressionMammalianPromoterCAG and U6Available sinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
FNLCR CRISPRa Cell Surface
Pooled library#207471PurposeCRISPR-based activation library with guide RNAs targeting all cell surface proteins.DepositorExpressionMammalianSpeciesHomo sapiensUseCRISPR and LentiviralAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLQ2840 pPB: CAG-Puro-WPRE PGK-VPR-tagBFP-SadCas9
Plasmid#84246PurposeExpresses direct fusion VPR-Sa dCas9DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsVPR-tagBFP-Sa dCas9
Puro
UseCRISPR and Synthetic Biology; PiggybacTagsNucleoplasmin NLS, SV40 NLS, VPR, and tagBFPExpressionMammalianPromoterCAG and PGKAvailable sinceNov. 10, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSLQ2833 pPB: CAG-PYL1-VPR-IRES-Zeo-WPRE-SV40PA PGK-ABI-tagBFP-SadCas9
Plasmid#84243PurposeExpresses ABA-inducible VPR-Sa dCas9DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsABI-tagBFP-Sa dCas9
PYL1-VPR
UseCRISPR and Synthetic Biology; PiggybacTagsABI-tagBFP-Nucleoplasmin NLS, IRES-Zeocin, PYL1, …ExpressionMammalianMutationD10A, N580A and Synonymous mutation in PYL1 to re…PromoterCAG and PGKAvailable sinceNov. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pM-Cas12a
Plasmid#196291Purpose35S promoter-driven expression of the positive-sense TSWV M RNA segment encoding LbCas12a in place of viral GPDepositorInsertFull length TSWV M antigenome encoding LbCas12a in place of viral GP (cas12a Synthetic)
UseCRISPRTagsFlagExpressionPlantMutationSee depositor comments belowPromoterduplicated cauliflower mosaic virus 35S promoterAvailable sinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti_EF1a_Flag_TP53_WT
Plasmid#183112PurposeExpresses flag-tagged p53 in mammalian cellsDepositorInsertTP53 (TP53 Human)
UseCRISPR and LentiviralExpressionMammalianMutationSee Depositor Comments BelowPromoterEF1aAvailable sinceAug. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRDA_426
Plasmid#179097PurposeBE Cas expressionDepositorInsertABE8e
UseCRISPR and LentiviralAvailable sinceJan. 20, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Rad51–Cas9(D10A)
Plasmid#125567PurposeExpresses the Rad51–Cas9(D10A) fusion construct in mammalian cells under CMV promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertRad51–Cas9(D10A) (RAD51 Human)
UseCRISPRExpressionMammalianAvailable sinceMay 21, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Lv EF1a MS2-Fkbp2x 2A Hygro
Plasmid#102807PurposeLentiviral plasmid from FIRE-Cas9 system to express MS2-Fkbp2x fusion proteinDepositorInsertMS2-Fkbp2x
UseCRISPR and LentiviralExpressionMammalianPromoterEF1aAvailable sinceDec. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPB-Ins-U6p-sgRNAentry-EF1Ap-TetOn3G-IRES-Neo
Plasmid#183411PurposepiggyBAC-based sgRNA entry (Esp3I) and Tet-On 3G transactivator expression vector. Insert protospacer and transfect with CRISPRa (183409) or CRISPRi (183410) plasmid for inducible epigenome editing.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTet-on 3G
UseCRISPR and Synthetic Biology; PiggybacExpressionMammalianPromoterEF1AAvailable sinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by