Skip to main content

We narrowed to 33,683 results for: IND

Showing: 4961 - 4980 of 33683 results
  1. pCu-His6-Atg13[571–700] K683E, H685E, K686E-Ss(424)

    Plasmid
    #166855
    Purpose
    Expresses 6xHis tagged ATG13 [571–700] fragment mutated in K683E, H685E, K686E with 14 scramble amino acid sequence DIKLIDTVDLESCN under a Cu promoter in yeast
    Depositor
    Insert
    Atg13[571–700] (ATG13 Budding Yeast)
    Tags
    6xHis
    Expression
    Yeast
    Mutation
    K683E, H685E, K686E
    Promoter
    pCu
    Available Since
    April 5, 2021
    Availability
    Academic Institutions and Nonprofits only
  2. pCu-His6-Atg13[571–700] F641E, I645E-Ss(424)

    Plasmid
    #166854
    Purpose
    Expresses 6xHis tagged ATG13 [571–700] fragment mutated in F641E, I645E with 14 scramble amino acid sequence DIKLIDTVDLESCN under a Cu promoter in yeast
    Depositor
    Insert
    Atg13[571–700] (ATG13 Budding Yeast)
    Tags
    6xHis
    Expression
    Yeast
    Mutation
    F641E, I645E
    Promoter
    pCu
    Available Since
    April 5, 2021
    Availability
    Academic Institutions and Nonprofits only
  3. pCu-His6-Atg13[571–700] F641G, I645G-Ss(424)

    Plasmid
    #166853
    Purpose
    Expresses 6xHis tagged ATG13 [571–700] fragment mutated in F641G, I645G with 14 scramble amino acid sequence DIKLIDTVDLESCN under a Cu promoter in yeast
    Depositor
    Insert
    Atg13[571–700] (ATG13 Budding Yeast)
    Tags
    6xHis
    Expression
    Yeast
    Mutation
    F641G, I645G
    Promoter
    pCu
    Available Since
    April 5, 2021
    Availability
    Academic Institutions and Nonprofits only
  4. pLKO.1-shGBP1.2.mKO2

    Plasmid
    #85210
    Purpose
    TRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.
    Insert
    GBP1 (guanylate binding protein 1) (GBP1 Human)
    Use
    Lentiviral and RNAi
    Expression
    Mammalian
    Promoter
    RNA polymerase III promoter for human U6 snRNA fo…
    Available Since
    Oct. 4, 2017
    Availability
    Academic Institutions and Nonprofits only
  5. pCS2+MLS-HyPer7

    Plasmid
    #136470
    Purpose
    Mammalian expression of mitochondrial matrix targeted ultrasensitive hydrogen peroxide indicator HyPer7 for optical imaging
    Depositor
    Insert
    HyPer7
    Tags
    Tandem mitochondrial targeting signal of cytochro…
    Expression
    Mammalian
    Promoter
    CMV, SP6
    Available Since
    Feb. 11, 2020
    Availability
    Academic Institutions and Nonprofits only
Showing: 4961 - 4980 of 33683 results