We narrowed to 35,544 results for: IND
-
Plasmid#110919PurposeTo overexpress Thioredoxin-1DepositorAvailable SinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pTYB11-PTBP1-RRM2CCtoSS
Plasmid#89154Purposerecombinant expression of PTBP1-RRM2 C250S,C251S in e.coliDepositorInsertPolypyrimidine Tract Binding Protein 1 RNA Recognition Motif 2 mutant C250S, C251S (PTBP1 Human)
TagsIntein and chitin binding domainExpressionBacterialMutationmutations: Cys 250 to Ser, Cys 251 to SerPromoterT7Available SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
MLM3720
Plasmid#49944PurposeExpresses a mutant TALE-TET1CD (inactive catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene for use as a controlDepositorInsert3x FLAG Tet1CDmut RH-3 (RHOXF2 Human)
UseTALENTags3x FLAGMutationcatalytic domain of TET1 inactive (H1671Y and D16…PromoterEF1aAvailable SinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLV-tetO-Id2
Plasmid#70764PurposeLentiviral plasmid for tetracycline/doxycycline dependent expression of murine Id2DepositorAvailable SinceNov. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pOPINO_H11
Plasmid#184277PurposeExpresses nanobody H11 in E. coliDepositorInsertNanobody H11
TagsHis6ExpressionBacterial, Insect, and Mamm…PromoterT7Available SinceFeb. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
CIBN-rTetR
Plasmid#183919PurposeOptogenetic CIBN localizer domain coupled to reverse Tet repressor; binds tetO sites upon doxycycline addition; CIBN is bound by PHR upon blue light exposureDepositorAvailable SinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
3019_pETcon-SARS-CoV-2-RBD_E484K
Plasmid#184404Purposeyeast surface display of the SARS-CoV-2 Eta variant RBDDepositorInsertSARS-CoV-2 Eta Spike receptor binding domain (RBD) (S SARS-CoV-2 virus)
TagsHA and c-MycExpressionYeastMutationE484KAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
T7pr-His6-MBP-TEV-dCas9-BirA*
Plasmid#159994PurposeBacterial expression of dCas9-BirA*DepositorInsertdCas9-BirA*
Tags6X-His, MBP, 3X-FLAG, NLSExpressionBacterialMutationD10A, H840APromoterT7Available SinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAcGFP-Hyg-CTCF-Nterm-N1
Plasmid#131800PurposeExpresses the [N-terminus of human CTCF (a.a. 2-265)]-GFP in mammalian cellsDepositorInsertCTCF (CTCF Human)
TagsGFPExpressionMammalianMutationdeleted amino acids 796-2181 (the N-terminus is l…Available SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
JA740
Plasmid#49939PurposeExpresses a TALE-TET1FL (full length TET1) fusion protein engineered to bind a site in EGFP for use as a controlDepositorAvailable SinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
ApoE3_mCh-SspB (pBS1144)
Plasmid#185326PurposeFor the mammalian expression of the human protein ApoE3 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertApoE3
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
MLM3762
Plasmid#49947PurposeExpresses a mutant TALE-TET1CD (inactive catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene for use as a controlDepositorInsert3x FLAG Tet1CDmut RH-4 (RHOXF2 Human)
UseTALENTags3x FLAGMutationcatalytic domain of TET1 inactive (H1671Y and D16…PromoterEF1aAvailable SinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
pESC-LEU-SopB
Plasmid#183670PurposeInducible Salmonella Typhimurium SopB for expression in yeastDepositorAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pESC-Leu-SopB(C460S)
Plasmid#183671PurposeInducible Salmonella Typhimurium SopB (catalytically inactive) for expression in yeastDepositorInsertsopB (sopB Salmonella enterica serovar Typhimurium)
ExpressionYeastMutationC460SPromoterGAL1Available SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmirGLO-Bmpr2-Δ17
Plasmid#49380PurposeInsert is a fragment of the Bmpr2 3'-UTR that contains a mutated miR-17 binding site. To be used for 3'UTR assay.DepositorInsertBmpr2 (BMPR2 Human, Mouse)
UseLuciferaseMutationchanged nucleotides AC to TG at bp 7347-7348PromoterHuman phosphoglycerate kinase (PGK) promoterAvailable SinceOct. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRS405 SEC66-VAC8-RFP
Plasmid#166843PurposeExpresses ER localized Vac8-RFP in yeasts. Made replacing the first 21 base pairs of the VAC8 ORF with the first 162 base pairs from the SEC66 ORF, which encode the Sec66 transmembrane domain.DepositorTagsRFP and SEC66 transmembrane domainExpressionYeastMutationSEC66 transmembrane domainPromoterVAC8 promoterAvailable SinceApril 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6P-1 AUP1 292-410
Plasmid#185331PurposeBacterial expression of AUP1 with GST fusion protein for binding assaysDepositorAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMXs-hGLIS1GR
Plasmid#59312PurposeForced expression of human GLIS1GRDepositorInsertGLIS1 (GLIS1 Human)
UseRetroviralTagscGR - hormone binding domain of glucocorticoid re…ExpressionMammalianAvailable SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
HOXA9 (murine) FLAG pRC/CMV
Plasmid#8514DepositorInsertHOXA9 (Hoxa9 Mouse)
TagsFLAG and HisExpressionMammalianMutationFLAG epitope tag replaces T7 tag in the pET back…Available SinceMay 30, 2006AvailabilityAcademic Institutions and Nonprofits only