We narrowed to 6,896 results for: tet
-
Plasmid#200837PurposeTranscribes a glmZ' (1-146)-gfp fusion. gfp can be replaced via AgeI/XbaI-sites with gene of interest to release its RNA with a 5' monophosphate upon cleavage.DepositorInsertglmZ (glmZ Escherichia coli str. K-12 substr. MG1655)
UseSynthetic BiologyTagsGFPExpressionBacterialPromoterP-LlacO-1Available SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1-Gata6-3xT7
Plasmid#200889PurposeInducible lentiviral expression of Gata6DepositorInsertGata6 (Gata6 Mouse)
UseLentiviral; Doxycycline inducibleTags3xT7ExpressionMammalianPromoterTRE promoter, Tet ONAvailable SinceJune 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-nsp7
Plasmid#201025PurposeExpresses SARS-CoV-2 nsp7 under control of a tetracycline-inducible promoter in mammalian.DepositorInsertnon-structural protein 7 (ORF1ab Severe acute respiratory syndrome coronavirus 2, Synthetic)
ExpressionMammalianPromoterCMV-tet-ONAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRE/SP M87 N184X
Plasmid#92373PurposeInducible expression of M87 N184X spastin in mammalian cellsDepositorInsertspastin (SPAST Human)
ExpressionMammalianMutation1-460 bp deleted, N184XPromoterTet-responsive P tightAvailable SinceJune 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTRE/SP M87 S245X
Plasmid#92374PurposeInducible expression of M87 S245X spastin in mammalian cellsDepositorInsertspastin (SPAST Human)
ExpressionMammalianMutation1-460 bp deleted, S245XPromoterTet-responsive P tightAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFRT-TODestGFP_RBPMS2
Plasmid#65747Purposeexpresses GFP-tagged RBPMS2 in mammalian cellsDepositorInsertRBPMS2 (RBPMS2 Human)
TagsGFPExpressionMammalianMutationS13N mutation in RBPMS2PromoterCMV, 2x TetAvailable SinceAug. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pASKt15C+SrtA5woH
Plasmid#65019PurposeExpresses the P94R/D160N/D165K/K190E/K196T mutant of Staphylococcus aureusDepositorInsertsortase A
TagsS tagExpressionBacterialMutationdeleted amino acids 1-59, P94R, D160N, D165A, K19…Promotertetracycline promoter/operatorAvailable SinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTwist GFP-Linker-VDAC1
Plasmid#211735PurposeExpresses GFP tagged VDAC1 in mammalian cells. GFP is attached to the N-terminus of VDAC1 with a flexible linker.DepositorAvailable SinceFeb. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCas9CR4-NG
Plasmid#120225PurposepCas9CR4 with mutations to change PAM site specificity to NG from Nishimasu et al.DepositorInsertSpCas9-NG
UseSynthetic BiologyTagsssrAMutationMutations R1335V/L1111R/D1135V/G1218R/E1219F/A132…PromoterpTetAvailable SinceJan. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ-FFSS-Cyclin D1 (HP)
Plasmid#215150PurposeExpresses FFSS-Cyclin D1 (HP) in mammalian cells from an inducible lentiviral vector.DepositorInsertCCND1 (CCND1 Human)
UseLentiviralTagsFFSS (FLAG-FLAG-STREP-STREP)ExpressionMammalianMutationCyclin D1(HP) denotes mutations M56A, V60A, and W…PromoterCMV (Tet inducible)Available SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFRT-TODestFLAGHA_RBPMS_R38E
Plasmid#65665PurposeFLAG-HA expression vector with RBPMS carrying mutation R38EDepositorInsertRBPMS (RBPMS Human)
TagsFLAG HAExpressionMammalianMutationchanged arginine 38 to glutamic acidPromoterCMV, 2x TetAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFRT-TODestFLAGHA_RBPMS_KDR_F65A
Plasmid#65092PurposeDestination vector with RBPMS resistant to siRNA treatment by s21729 (Applied Biosystems) with F65A mutation for stable cell line generationDepositorInsertRBPMS (RBPMS Human)
TagsFLAG HAExpressionMammalianMutationchange phenylalanine 65 to alanine (KDR backbone)PromoterCMV, 2x TetAvailable SinceJune 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFRT-TODestFLAGHA_RBPMS_KDR_F27A
Plasmid#65661PurposeFLAG-HA expression vector with RBPMS carrying mutation F27A and encoding silent mutation to render resistant to siRNA R2 (Farazi et al. 2014)DepositorInsertRBPMS (RBPMS Human)
TagsFLAG HAExpressionMammalianMutationchanged phenylalanine 27 to alanine (KDR backgrou…PromoterCMV, 2x TetAvailable SinceJune 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHLEGM4
Plasmid#24783DepositorInsertPtet-Gfp-ASV
ExpressionBacterialAvailable SinceAug. 4, 2010AvailabilityAcademic Institutions and Nonprofits only -
circRAJ31
Plasmid#69926PurposeExpresses RAJ31 riboregulator encased in a permuted intron exon ribozyme, which circularises the riboregulator.DepositorInsertplTet-circRAJ31
UseSynthetic BiologyExpressionBacterialPromoterPltetO1-2Available SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ubiquiton Yeast Kit
Plasmid Kit#1000000243PurposePlasmids for inducible, linkage-specific polyubiquitylation of a protein of interest in yeast.DepositorApplicationGene Expression and LabelingVector TypeYeast ExpressionAvailable SinceMay 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKB223
Plasmid#170013PurposeEncodes LacI-controlled expression of surface-displayed C18G and PvirK-mNeonGreen reporterDepositorArticleInsertsmNeonGreen
C18G
UseSynthetic BiologyTagsLpp, OmpA, and TetherExpressionBacterialPromoterPtac and PvirKAvailable SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLQ-KO-tgt50
Plasmid#126578PurposeCRISPR-Cas9 based efficient genome editing in S. aureusDepositorInsertCas9-Pxyltet-sgRNA-Pspac-donor-tgt50
UseCRISPRExpressionBacterialAvailable SinceJune 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
EW446 CMV-TO-ADAR2dd(E488Q, T501A) (FLP-IN)
Plasmid#236125PurposePlasmid encoding free ADAR2dd under control of CMV promoter with two TetR binding sitesDepositorInsertADAR2dd (ADARB1 Human, Synthetic)
ExpressionMammalianMutationE488Q, T501APromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only