We narrowed to 6,800 results for: &alpha
-
Plasmid#168124PurposeEncodes a BRET-based activity sensor for the heterotrimeric G protein Gs. Composed of the subunits G alpha s(short isoform) (GNAS) tagged with NanoLuciferase, G beta 1 (GNB1) and Venus-tagged G gamma 1 (GNG1).DepositorUseLuciferaseTagscpVenus on GNG1ExpressionMammalianMutationNLuc is inserted at N136/V137 within GNASAvailable SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only
-
G13-CASE
Plasmid#168127PurposeEncodes a BRET-based activity sensor for the heterotrimeric G protein G13. Composed of the subunits G alpha 13 (GNA13) tagged with NanoLuciferase, G beta 3 (GNB3) and Venus-tagged G gamma 9 (GNG9).DepositorUseLuciferaseTagscpVenus on GNG9ExpressionMammalianMutationNLuc is inserted at F125/D126 within GNA13Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
Gi2-CASE
Plasmid#168121PurposeEncodes a BRET-based activity sensor for the heterotrimeric G protein Gi2. Composed of the subunits G alpha i2 (GNAI2) tagged with NanoLuciferase, G beta 1 (GNB1) and Venus-tagged G gamma 2 (GNG2).DepositorUseLuciferaseTagscpVenus on GNG2ExpressionMammalianMutationNLuc is inserted at C112/E115 within GNAI2Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
G12-CASE
Plasmid#190714PurposeEncodes a BRET-based activity sensor for the heterotrimeric G protein G12. Composed of the subunits G alpha 12 (GNA12) tagged with NanoLuciferase, G beta 3 (GNB3) and Venus-tagged G gamma 9 (GNG9).DepositorUseLuciferaseTagsNluc is inserted at A133/F134 within GNA12 and cp…ExpressionMammalianAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSt1374-N-NLS-DNMT3L-L-DNMT3A-L-dcas9-NLS
Plasmid#112210PurposeTargeted DNA methylationDepositorAvailable SinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLZRS-ER-Rac1-Q61L-shortlinker
Plasmid#128584PurposeFor mammalian cell expression of Q61L mutant murine RAC1 carrying a modified hormone-binding domain of murine ERalpha at the N-terminus. Activation of expressed latent fusion protein induced by 4-OHTDepositorInsertRac1 (Rac1 Mouse)
UseRetroviralTagsModified hormone binding domain of ER alphaExpressionMammalianMutationChanged Glutamine61 to Leucine in the RAC1 moiety.Available SinceAug. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLZRS-ER-Rac1-P29S-shortlinker
Plasmid#128583PurposeFor mammalian cell expression of P29S mutant murine RAC1 carrying a modified hormone-binding domain of murine ERalpha at the N-terminus. Activation of expressed latent fusion protein induced by 4-OHTDepositorInsertRac1 (Rac1 Mouse)
UseRetroviralTagsModified hormone binding domain of ER alphaExpressionMammalianMutationChanged Proline29 to Serine in the RAC1 moiety.Available SinceAug. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAdeasy-CMV-AE-EF1α-R2
Plasmid#194928Purposeexpressing two fusion proteins of Ag85B-ESAT6 and Rv2031c-Rv2626c from multi-stage antigens of Mycobacterium tuberculosisDepositorInsertsUseAdenoviralTagsAg85B-ESAT6, EF1a, and Rv2031c-Rv2626cMutationa 48 bp linker (Gly3ser)4 was added between the t…PromoterCMV and EF1aAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_PRKCA_WT
Plasmid#82225PurposeGateway Donor vector containing PRKCA , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMG051 MBP-β-catenin-His, GST-CK1α
Plasmid#154072PurposeCo-expresses MBP-β-catenin-His (human β-catenin as a fusion protein with MBP and His- tags) and GST_CK1α in E.coli to produce primed MBP-β-catenin-HisDepositorTagsGST, His6, and MBPExpressionBacterialPromoterTacAvailable SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-IL1R1-Fc(DAPA)-AviTag-6xHis
Plasmid#156756PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertIL1R1 (IL1R1 Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMV1 pEF1a-HGF
Plasmid#188748PurposeVector constitutively expressing HGFDepositorAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
SFFV-CEBPA-Brd 467
Plasmid#219368PurposeTranscription factor CEBPA with a specific barcode assigned.DepositorAvailable SinceOct. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLX304_zeo_mmFbxw7a
Plasmid#160102PurposeExpresses murine Fbxw7 alpha in mammalian cellsDepositorAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
hU6-pegRNA-EF-1α-Cre Template
Plasmid#196036PurposeThe template UPEC vector designed for cloning of a single pegRNA and subsequent co-expression with Cre.DepositorTypeEmpty backboneExpressionMammalianPromoterhU6 and EF-1-alphaAvailable SinceJune 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pWZL Neo Myr Flag PIP5K1A
Plasmid#20580DepositorAvailable SinceOct. 27, 2009AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-FCGRT-Fc(DAPA)-AviTag-6xHis
Plasmid#156820PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertFCGRT (FCGRT Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-TNF-Fc(DAPA)-AviTag-6xHis
Plasmid#156575PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertTNF (TNF Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_WW-PolyA
Plasmid#112290PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) WW mutant. WQDP (199-202) in the first WW domain was changed to AQDA, and the WLDP (258-261) of the second WW domain was changed to ALDADepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralMutationHuman YAP1-2gamma with mutations in the WW domain…PromoterEF-1 alphaAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only