We narrowed to 14,057 results for: Mpl
-
Plasmid#132528PurposeHuman TCTEX-1, codon optimised for Sf9 expression.DepositorAvailable SinceOct. 28, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pRS406 ATG1-ATG17-3'UTR
Plasmid#166848PurposeExpresses Atg1 with ATG17 3'UTR in yeasts.DepositorAvailable SinceApril 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
mr in pUASP
Plasmid#112981PurposeP element vector for transposon insertion of mr (APC2) into Drosophila genomeDepositorInsertmr (APC2) (mr Fly)
UseP insertion vectorAvailable SinceAug. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJZC40
Plasmid#62334PurposesgRNA + 2x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 2x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
pCFJ2210 - [1-2] ENTR - Fluor - mMaple3(1 intron, syntrons(3), no_start, no_stop)
Plasmid#159864PurposeThree-fragment Gateway compatible flourophore for expression in C. elegansDepositorInsert[1-2] ENTR - Fluor - mMaple3(1 intron, syntrons(3), no_start, no_stop)
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-N1-hRIP3-FL V460P
Plasmid#61379PurposeExpresses Human full length RIPK3 with V460P mutation in the mammalian cellsDepositorInsertFull length human RIP3 with V460Pmutation (RIPK3 Human)
TagsEYFPExpressionMammalianMutationchanged V460 to PAvailable SinceJan. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-N1-hRIP3-FL V458P
Plasmid#61377PurposeExpresses Human full length RIPK3 with V458P mutation in the mammalian cellsDepositorInsertFull length human RIP3 with V458Pmutation (RIPK3 Human)
TagsEYFPExpressionMammalianMutationchanged V458 to PAvailable SinceJan. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmCup_C
Plasmid#146041PurposeInsect Expression of DmCupDepositorAvailable SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
As3 (pBW411J117-arsR)
Plasmid#123142PurposeAn arsenic sensor with optimized intracellular receptor density. Also used in the sensor cell array. pSB3K3 carrying J117-30arsR-t-ParsR-30gfp-tDepositorInsertJ117-30arsR-t-ParsR-30gfp-t
UseSynthetic BiologyExpressionBacterialPromoterJ117, ParsRAvailable SinceMay 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEXP5-NT-CuSeCat
Plasmid#42568DepositorInsertmutated calmodulin gene
TagsPolyhistidine (6×His) region, TEV recognition sit…ExpressionBacterialMutationchanged Phenylalanine 92 to Glutamine acid, Valin…PromoterT7Available SinceMarch 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMDJ16 - pEXP[Peft-3 | mMaple3 (NLS) | tbb-2 UTR]
Plasmid#159802PurposeExpression construct with ubiquitous expression to test fluorescence level on microscopeDepositorInsertpEXP[Peft-3 | mMaple3 (NLS) | tbb-2 UTR]
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVH028
Plasmid#80393PurposeContains constitutive histidine kinase (pCon-Taz) with 4x SH3 scaffold domains + salicylate inducible phosphatase (Psal-CusSmut)DepositorUseSynthetic BiologyTagsFused by GS linkers to 4 SH3 domainsExpressionBacterialMutationGlycine 448 changed to Alanine, makes it primaril…Available SinceNov. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
p224 pCMV-RFP/CREM
Plasmid#8401PurposeFloxed RFP inserted within the coding sequence of cre recombinase.DepositorInsertRFP/CREM
UseCre/LoxExpressionMammalianMutationmodified Cre, LOX 511 sites surrounding RFP withi…PromoterCMVAvailable SinceAug. 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1X-Nup88-mut
Plasmid#87337PurposeTo express human Nup88 in mammalian cells. It contains synonymous mutations that are not targeted by shRNADepositorInsertNUP88 (NUP88 Human)
TagsEGFPExpressionMammalianMutationshRNA resistant changesPromoterCMVAvailable SinceMay 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2262A - [1-2] ENTR - Fluor - ce-mNeon (1 intron, syntrons(3), no_atg, no_stop)
Plasmid#159851PurposeThree-fragment Gateway compatible flourophore for expression in C. elegansDepositorInsert[1-2] ENTR - Fluor - ce-mNeon (1 intron, syntrons(3), no_atg, no_stop)
ExpressionWormMutationNot applicableAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmCaf40
Plasmid#79251PurposeExpresses EGFP-tagged DmCaf40 in S2 cellsDepositorAvailable SinceJuly 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pIK137
Plasmid#65632PurposeExpresses gfp::h2b in C. elegans cells from the ubiquitous eef-1A.1 (eft-3) promoter and contains a C. briggsae unc-119 rescuing fragmentDepositorInsertPeft-3::gfp::h2b::tbb-2 3'UTR, C. briggsae unc-119 rescue fragment
ExpressionWormAvailable SinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
YFP(159-238) in pcDNAI/Amp
Plasmid#60889PurposeThis vector attaches YFP(159-238) to the N-terminus of a protein.DepositorInsertYFP(159-238)
ExpressionMammalianPromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA-REDD1 S103L (#624)
Plasmid#99942Purposemammalian expressionDepositorAvailable SinceNov. 7, 2017AvailabilityAcademic Institutions and Nonprofits only