We narrowed to 12,540 results for: /1000
-
Plasmid#207751PurposeDonor template for Blast-2A-mNeon insertion into the N-terminus of the ACTB locus for actin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-ACTB Addgene #207748DepositorInsertACTB Homology Arms flanking a Blast-mNeon Cassette (ACTB Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRC54-DHX37-GFP
Plasmid#192149Purposeexpress DHX37-GFPDepositorAvailable SinceNov. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1+_FH-AGO2-5xA
Plasmid#92007PurposeExpresses FLAG-HA-AGO2 [S824A, S828A, T830A, S831A, S834A (5xA)]DepositorInsertAGO2 (AGO2 Human)
TagsFLAG-HAExpressionMammalianMutationS824A, S828A, T830A, S831A, S834A (5xA)Available SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTetON-BMP2/7
Plasmid#137913PurposeInducible mammalian co-expression vector for human bone morphogenetic protein 2 and 7 cDNAs (2 transcriptional units, divergent)DepositorAvailable SinceMarch 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
Flag-Bcl2-Cb5
Plasmid#18004DepositorInsertER targeted Bcl-2 (BCL2 Human)
TagsFlagExpressionMammalianMutationC terminal of Bcl-2 replaced with Cytochrome b5. …PromoterCMVAvailable SinceJune 4, 2008AvailabilityAcademic Institutions and Nonprofits only -
pHAND1-T2A-dTom-PGK-Neo
Plasmid#209838PurposeTomato reporter plasmid targeting the human HAND1 geneDepositorInsertHAND1-T2A-dTomato-PGK-Neo-HAND1 (HAND1 Human)
UseHuman targetingAvailable SinceMarch 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
EDNRB-DuET
Plasmid#213233PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1+_FH-AGO2-5xE
Plasmid#92008PurposeExpresses FLAG-HA-AGO2 [S824E, S828E, T830E, S831E, S834E (5xE)]DepositorInsertAGO2 (AGO2 Human)
TagsFLAG-HAExpressionMammalianMutationS824E, S828E, T830E, S831E, S834E (5xE)Available SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
ACTB-(A)1x
Plasmid#112055PurposeACTB mRNA tagged with 1 copy of Riboglow (variant A)DepositorInsertACTB (ACTB Human)
TagsRiboglow RNA tagExpressionMammalianMutation1 copy of Riboglow tag (variant A) after stop cod…PromoterCMVAvailable SinceJune 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-EGFPC-uL10-(Neo)R
Plasmid#158069PurposeeGFP and uL10 ribosomal protein under the TRE3G promoter, Neo resistanceDepositorAvailable SinceNov. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
EDNRB-Tango
Plasmid#66274PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGLS3-5xHRE-p53(K120R)
Plasmid#72554PurposeHypoxia induced mutant p53. Contains the HRE from VEGF sequence (5 repeats) upstream of p53 K120R.DepositorInsertp53 (TP53 Human)
Tags5XHREExpressionMammalianMutationK120RPromoterE1B minimal promoterAvailable SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
sg_Trp53_i4-ipUSEPR-TR657
Plasmid#228930PurposeKnockdown of Trp53 in mammalian cellsDepositorInsertsg_Trp53_i4 (Trp53 Mouse, sequence: GTCGCTACCTACAGCCAGGA)
UseLentiviralAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2-GJA1-S373A
Plasmid#52879PurposeEncodes human Connexin 43 resistant to siRNA with Serine to Alanine mutation at 373DepositorAvailable SinceMay 12, 2014AvailabilityAcademic Institutions and Nonprofits only -
mCerulean3-Bcl-2-s2193
Plasmid#166750PurposeExpress mCerulean3 fused to the N-terminus of the Bcl-2 family protein, Bcl-2 in a plasmid with Blasticidin resistance. Used to make stable BMK-DKO cell lines.DepositorAvailable SinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHAGE GFP-Ago2 S387A
Plasmid#60654PurposeGFP-Ago2 S387A mutant lentiviral vectorDepositorAvailable SinceMay 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Tag2-Sox9 T236A
Plasmid#111455PurposeTransient expression of Flag-tagged human Sox9 with T236A mutationDepositorAvailable SinceJune 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
TFORF1466
Plasmid#143503PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTRE-TAZ-CAMTA1
Plasmid#235680PurposeExpress TAZ-CAMTA1 fusion gene in mammalian cells using the doxycycline-inducible TRE promoterDepositorAvailable SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS-mEmerald-VIM
Plasmid#62849PurposeDonor vector for gene editing at human VIM locusDepositorInsertmEmerald-VIM (VIM Human, Synthetic)
UseYeast-e.coli shuttle vectorAvailable SinceMay 26, 2015AvailabilityAcademic Institutions and Nonprofits only