We narrowed to 11,733 results for: aga
-
Plasmid#77095Purpose3rd generation lentiviral gRNA plasmid targeting human SPHK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pLT 651
Plasmid#59998PurposeExpresses a hybrid dsRNA corresponding to the Caenorhabditis elegans klp-16/him-8 genes in bacteria; ingestion of the bacteria by C elegans produces an RNAi response & leads to more male progenyDepositorExpressionBacterialMutationpartial genomicAvailable SinceApril 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
M51
Plasmid#242620PurposeStrep-MYC-His protein expression in bacteriaDepositorAvailable SinceSept. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBABE-puro-Halo-hMRE11(wt)
Plasmid#208393PurposeTo generate stable cell line expressing Halo-human MRE11(WT) by Retroviral infection.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRRL.SIN.EF1A.JAG1-B5.GS.CAR-3G
Plasmid#194464PurposeCAR featuring: GMCSF (sig. peptide); CD8A & CD8A (hinge & TM); CD28, 4-1BB & CD3ζ (signaling domains); anti-JAG1 from J1.B5 in VH-VL order & (GGGGS)3 linker (scFv). GFP-Zeo for selection & monitoring.DepositorInsertAnti-JAG1 CAR
UseLentiviralAvailable SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBW2287_pCAG-PV1-PYL-L1-FlpO-397C-NLS-BGHpA
Plasmid#108770PurposeExpresses aa397 to C-terminus of Flp recombinase fused to PYL CIDDepositorInsertFlp recombinase fragment aa397 to C-terminus
UseCre/Lox and Synthetic BiologyTagsNLS and PYLExpressionMammalianPromoterpCAGAvailable SinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0 mCherry-hCortKD-Flcortmut3YD
Plasmid#187266PurposeLentiviral expression of shRNA targeting Cortactin + reconstitution of Cortactin3YD mutantDepositorInsertCortactin (CTTN Human)
UseLentiviralTagsmCherryMutation3YD (Y412, Y470, Y486)PromoterU6, 5'LTRAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0 hCortKD-Flcortmut3YF mCherry
Plasmid#187265PurposeLentiviral expression of shRNA targeting Cortactin + reconstitution of Cortactin3YF mutantDepositorInsertCortactin (CTTN Human)
UseLentiviralTagsmCherryMutation3YF (Y412, Y470, Y486)PromoterU6, 5'LTRAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR-SFFV- MOG-VHVL-M26-synNotch-Gal4VP64
Plasmid#247467PurposeExpresses a synNotch binding to myelin oligodendrocyte glycoproteinDepositorInsertsynNotch receptor using a scFvs binding MOG
UseLentiviralExpressionMammalianAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-SMS1-TEV-HAT
Plasmid#202557PurposeExpress C-terminal Tobacco Etch Virus (TEV) protease cleavable HAT-tagged human Sphingomyelin synthase 1 (SMS1) in mammalian cellDepositorInsertSGMS1 (SGMS1 Human)
TagsHistidine-Affinity-tag (HAT) and TEV cleavable si…ExpressionMammalianMutationdeleted stop codon (TAA)PromoterCAG and chicken β-actin promoterAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBW2436_pCAG-PV1-GAI-L1-Cre-271C-NLS-BGHpA
Plasmid#108730PurposeExpresses aa271 to C-terminus of Cre recombinase fused to GAI CIDDepositorInsertCre recombinase fragment aa271 to C-terminus
UseCre/Lox and Synthetic BiologyTagsGAI and NLSExpressionMammalianPromoterpCAGAvailable SinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
GFP KNL1 wt hardened and RVSF->AAAA
Plasmid#45225DepositorInsertGFP KNL1 with RVSF-AAAA mutation, resistant to KNL1 siRNA (KNL1 Human)
MutationRVSF mutated to AAAAAvailable SinceMay 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynapsin1.OxLight-ctr
Plasmid#169793PurposeControl non-binding fluorescent reporter for orexin neuropeptidesDepositorInsertOxLight-ctr
UseAAVMutationE54K; T111APromoterhuman Synapsin-1Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28a(+) NRP1 b1 (273-427)
Plasmid#162734PurposeBacterial expression of the b1 domain from the human Neuropilin 1 receptor (NRP1). With an N-terminal 6His tag and thrombin cleavage site.DepositorInsertHuman NRP1 b1 domain residues 273-427
ExpressionBacterialMutationCodon optimisedAvailable SinceApril 27, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBW2614_pCAG-PV1-GAI-L2-28-396-FlpO-ABI-NLS-BGHpA
Plasmid#108833PurposeExpresses aa28 to aa396 of Flp recombinase fused to GAI and ABI CIDsDepositorInsertFlp recombinase fragment aa28 to aa396
UseCre/Lox and Synthetic BiologyTagsABI,NLS and GAIExpressionMammalianPromoterpCAGAvailable SinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase validation vector_ORI_SV40
Plasmid#99309PurposeLuciferase validation vector with SV40 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertSV40 enhancer
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable SinceSept. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDEST53-LRRK2-Y1699C
Plasmid#25048DepositorAvailable SinceJune 17, 2010AvailabilityAcademic Institutions and Nonprofits only -
pAAV CMV-DIO-(mCherry-U6)-shRNA(anti-Crh)
Plasmid#214732PurposeExpresses shRNA against CRH, marked with mCherry, in infected and cre positive cellsDepositorInsertanti-Crh shRNA / mCherry
UseAAVAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHRIG-AktDN
Plasmid#53597Purposelentiviral expression of dominant negative mouse Akt1 and EGFPDepositorInsertAkt1 (Akt1 Mouse)
UseLentiviralTagsHA and IRES-EGFPExpressionMammalianMutationDominant negative (K179M)PromoterCMVAvailable SinceAug. 25, 2014AvailabilityAcademic Institutions and Nonprofits only