We narrowed to 7,014 results for: tac
-
Plasmid#36336DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only
-
-
pX459-HypaCas9-ECT2_sgRNA
Plasmid#183873PurposepX459V2.0-HypaCas9 plasmid with ECT2 sgRNA for N-terminal tagging of Ect2 in human cells.DepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
TRCN0000072225
Plasmid#78160PurposeshLacZ controlDepositorInsertLacZ
UseLentiviral and RNAiPromoterhU6 and hU6Available SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgMETAP1_2
Plasmid#163463Purposelentiviral vector expressing Cas9 and an sgRNA targeting METAP1DepositorInsertsgRNA 2 targeting METAP1 (METAP1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPlacPbuCas13b-gRNA-T-MS2
Plasmid#184839PurposeExpression of a single-spacer CRISPR array with spacer #1 targeting the MS2 phage genome and expression of PbuCas13b in bacteria.DepositorInsertsingle-spacer CRISPR array with spacer #1 targeting the MS2 phage genome, PbuCas13b nuclease
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23119 and lac promoterAvailable SinceOct. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
OR6K6_Deletion_gRNA2
Plasmid#195196Purposedual gRNAs for deletion of OR6K6 in a third generation Cas9 backbone with GFPDepositorInsertOR6K6 dual gRNA (OR6K6 Human)
ExpressionMammalianAvailable SinceFeb. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
OR6K6_Deletion_gRNA1
Plasmid#195195Purposedual gRNAs for deletion of OR6K6 in a third generation Cas9 backbone with GFPDepositorInsertOR6K6 dual gRNA (OR6K6 Human)
ExpressionMammalianAvailable SinceFeb. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
ROCK2 gRNA (BRDN0001147800)
Plasmid#76349Purpose3rd generation lentiviral gRNA plasmid targeting human ROCK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJZC32
Plasmid#62327PurposesgRNA (no RNA aptamer addition) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLCKO_PSMD1_sgRNA_1
Plasmid#74180Purposelentiviral vector expressing sgRNA targeting PSMD1DepositorInsertPSMD1 sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6 PromoterAvailable SinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
AA286
Plasmid#215948PurposeFragmid fragment: (guide cassette) guide expression; positive control cell surfaceDepositorHas ServiceCloning Grade DNAInsertU6_v1; sgCD47_v6; trRNA_v4 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgRNA1_IL1RN
Plasmid#64140PurposePhotoactivatable transcription system. Lentiviral expression of IL1RN sgRNA1. Also contains a CMV-puro-t2A-mCherry expression cassetteDepositorAvailable SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
EC71167
Plasmid#154066PurposeLevel 1 Position 3 Golden Gate vector, pL1M-R3-UbqP-Loxp-ER-Targ-mCherry-HDEL-Loxp-eGFPDepositorInsertZmUBI::lox-mCHERRY-lox-T35S-eGFP-TAct
UseSynthetic BiologyMutationAll BsaI, Esp3I and BPiI restriction sites were r…PromoterZea mays Ubiquitin PromoterAvailable SinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA1 E638K
Plasmid#139327PurposePlasmid expressing a sgRNA to introduce BRCA1 E638K using base editingDepositorInsertsgRNA to insert BRCA1 E638K using base editing
ExpressionMammalianPromoterU6Available SinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
Myopathy Loop Mutant Nuclear Myosin I YFP
Plasmid#60243PurposeExpresses a myopathy loop mutant (6 mutations) of the nuclear isoform of myosin IC attached to YFP and an NLS, which has impaired actin binding activityDepositorInsertNuclear Myosin 1 (Myo1c Mouse)
TagsEYFP and NLSExpressionMammalianMutationDeleted I339, I340, G343, E344, E345,L346PromoterCMVAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001147780)
Plasmid#80226Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRCN0000231725
Plasmid#78163PurposeshRFP controlDepositorInsertRFP
UseLentiviral and RNAiPromoterhU6 and hU6Available SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX458_NFIA_iso1_2
Plasmid#104049PurposeEncodes gRNA for 3' target of human NFIA_iso1 along with Cas9 with 2A GFPDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shRBFOX1-3261
Plasmid#115458PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only