-
Plasmid#122929PurposeBacterial expression of RALA D130GDepositorInsertRALA (RALA Human)
UseTagsHisExpressionBacterialMutationD130GPromoterT7Available sinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
RALA S157A
Plasmid#122930PurposeBacterial expression of RALA S157ADepositorInsertRALA (RALA Human)
UseTagsHisExpressionBacterialMutationS157APromoterT7Available sinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
RALA R176X
Plasmid#122931PurposeBacterial expression of RALA R176XDepositorInsertRALA (RALA Human)
UseTagsHisExpressionBacterialMutationR176XPromoterT7Available sinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
-
pcDNA-dCas9-p300 Core
Plasmid#61357Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664) driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (EP300 S. pyogenes, Human, Synthetic)
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterCMVAvailable sinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-dCas9-p300 Core (D1399Y)
Plasmid#61358Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664; inactivating mutation D1399Y) driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (EP300 S. pyogenes, Human, Synthetic)
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9; D1399Y mutation i…PromoterCMVAvailable sinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Sport6-CD63-pHluorin
Plasmid#130901PurposeExpression of CD63-pHluorin for visualization of multivesicular body-plasma membrane fusion.DepositorInsertCD63-pHluorin (CD63 Aequorea victoria, Human)
UseTagspHluorinExpressionMammalianMutationpHluorin inserted between Gln-36 and Leu-37 in ex…PromoterCMVAvailable sinceOct. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
SARS-CoV-2 S HexaPro
Plasmid#154754PurposeMammalian expression vector for expression of the SARS-CoV-2 spike HexaPro variantDepositorInsertSpike (HexaPro variant) (S Severe acute respiratory syndrome coronavirus 2)
UseTags2X Strep-Tag II, 8X His tag, and HRV 3C cleavage …ExpressionMammalianMutationEctodomain only (AAs 1-1208); 682-685 (furin site…PromoterAvailable sinceJuly 1, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCMV-Sport6-CD63-pHuji
Plasmid#130902PurposeExpression of CD63-pHuji for visualization of multivesicular body-plasma membrane fusion.DepositorInsertCD63-pHuji (CD63 synthetic, Human)
UseTagspHujiExpressionMammalianMutationpHuji inserted between Gln-36 and Leu-37 in extra…PromoterCMVAvailable sinceOct. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Sport6-CD9-pHluorin
Plasmid#130905PurposeExpression of CD9-pHluorin for visualization of multivesicular body-plasma membrane fusion.DepositorInsertCD9-pHluorin (CD9 Aequorea victoria, Human)
UseTagspHluorinExpressionMammalianMutationphluorin inserted between Asn-50 and Asn-51 in ex…PromoterCMVAvailable sinceFeb. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Sport6-CD81-pHluorin
Plasmid#130903PurposeExpression of CD81-pHluorin for visualization of multivesicular body-plasma membrane fusion.DepositorInsertCD81-pHluorin (CD81 aequorea victoria, Human)
UseTagspHluorinExpressionMammalianMutationpHluorin inserted between Leu-49 and Gly-50 in ex…PromoterCMVAvailable sinceOct. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Sport6-CD81-pHuji
Plasmid#130904PurposeExpression of CD81-pHuji for visualization of multivesicular body-plasma membrane fusion.DepositorInsertCD81-pHuji (CD81 Human, Synthetic)
UseTagspHujiExpressionMammalianMutationpHuji inserted between Leu-49 and Gly-50 in extra…PromoterCMVAvailable sinceOct. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Sport6-CD9-pHuji
Plasmid#130906PurposeExpression of CD9-pHuji for visualization of multivesicular body-plasma membrane fusion.DepositorInsertCD9-pHuji (CD9 Human, Synthetic)
UseTagspHujiExpressionMammalianMutationpHuji inserted between Asn50 and Asn51 in extrace…PromoterCMVAvailable sinceFeb. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-dCas9-p300 Core (Y1467F)
Plasmid#61362Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664; inavtivating mutation Y1467F) driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (EP300 S. pyogenes, Human, Synthetic)
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9; Y1467F mutation i…PromoterCMVAvailable sinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHIS-MDH1-HIS
Plasmid#184558PurposeBacterial expression of human MDH1 with HIS TagDepositorInsertMalate dehydrogenase 1 (MDH1 Human)
UseTags6xHISExpressionBacterialMutationPromoterAvailable sinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-dCas9-p300 Core (1645/1646 RR/EE)
Plasmid#61359Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664; mutation 1645/1646 RR/EE) driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (EP300 S. pyogenes, Human, Synthetic)
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9; 1645/1646 RR/EE m…PromoterCMVAvailable sinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-dCas9-p300 Core (1396/1397 SY/WW)
Plasmid#61363Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664; inactivating mutation 1396/1397 SY/WW) driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (EP300 S. pyogenes, Human, Synthetic)
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9; 1396/1397 SY/WW m…PromoterCMVAvailable sinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-dCas9-p300 Core (C1204R)
Plasmid#61361Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664; mutation C1204R) driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (EP300 S. pyogenes, Human, Synthetic)
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9; C1204R mutation i…PromoterCMVAvailable sinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-dCas9-p300 Core (H1415A/E1423A/Y1424A/L1428S/Y1430A/H1434A)
Plasmid#61364Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664; inactivating mutations H1415A/E1423A/Y1424A/L1428S/Y1430A/H1434A) driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (EP300 S. pyogenes, Human, Synthetic)
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9; H1415A/E1423A/Y14…PromoterCMVAvailable sinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLPC-puromycin-binary-MDH1-3xFLAG-ME1- HA
Plasmid#184549PurposeRetroviral vector to co-express human MDH1 with 3xFLAG tag and human ME1 with HA tagDepositorUseRetroviralTags3xFLAG and HA tagExpressionMammalianMutationPromoterCMVAvailable sinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUltra-MDH1-ME1
Plasmid#184465PurposeLentiviral vector for tri-cistronic expression of EGFP, MDH1 and ME1 (seperated by P2A and T2A)DepositorUseLentiviralTagsfused to T2AExpressionMammalianMutationdeletion of stop codonPromoterUbCAvailable sinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ spike_del19
Plasmid#155297PurposeExpression of spike with C-term deletion of 19 aa, used to generate high efficiency SARS-CoV-2-pseudotyped lentiviral particlesDepositorInsertSARS-Cov2 spike_deleted (S SARS-Cov2)
UseGeneration of sars-cov-2-pseudotyped lentiviral p…TagsExpressionMutationDeletion in C-term 19 aa of spikePromoterCMVAvailable sinceAug. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEB-C5
Plasmid#28213Purpose5 reprogramming factors (OCT4, SOX2, KLF4, c-MYC and LIN28) are expressed as a single poly-cistronic unitDepositorUseTagsExpressionMammalianMutationPromoterAvailable sinceJune 20, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-blast shGFP
Plasmid#110419PurposeshGFP control, silence GFP gene, blasticidin selection.DepositorInsertGFP
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterU6 (RNA PolIII)Available sinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL10-PV_3C
Plasmid#203472PurposeExpresses PV 3C protease from a GAL10 promoter with a URA3 markerDepositorInsertPV 3C protease (PVgp1 )
UseTagsExpressionYeastMutationPromoterGAL10Available sinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.puro_shGFP
Plasmid#110421PurposeshGFP control, silence GFP gene, doxycycline inducible, puromycin selectionDepositorInsertGFP
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterH1/TO (RNA PolIII)Available sinceJune 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.puro_shLuc
Plasmid#110422PurposeshLuc control, silence Luc gene, doxycycline inducible, puromycin selectionDepositorInsertLuciferase
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterH1/TO (RNA PolIII)Available sinceJune 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRS414-7x2-PHO5-GFP-hPLC delta PH domain dimer
Plasmid#58837PurposeExpresses GFP-Tagged Human PLC delta PH domain in yeastDepositorInsert2x Phospolipase C delta1 PH domain (Plcd1 Rat)
UseTagsGFPExpressionYeastMutationPromoterPHO5Available sinceSept. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSAV108
Plasmid#226323PurposeEmpty backbone plasmid for genomic insertions into H. neapolitanus neutral siteDepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterAvailable sinceOct. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-blast shLuc
Plasmid#110409PurposeshLuc (Target TTACGCTGAGTACTTCGA), silence LUC gene, blasticidin selection.DepositorInsertLuciferase
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterU6 (RNA PolIII)Available sinceNov. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.puro_shHuR CDS
Plasmid#110411PurposeTRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene, doxycycline inducible, puromycin selectionDepositorInsertELAVL1 (HuR)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterH1/TO (RNA PolIII)Available sinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.puro_shGAC
Plasmid#110423PurposeshGAC, silence glutaminase GAC isoform, doxycycline inducible, puromycin selectionDepositorInsertGLS glutaminase (GLS Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterH1/TO (RNA PolIII)Available sinceJune 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.puro_shHuR 3UTR
Plasmid#110412PurposeTRCN0000276186 (Target TTGTTAGTGTACAACTCATTT), silence human ELAVL1 (HuR) gene, doxycycline inducible, puromycin selectionDepositorInsertELAVL1 (HuR)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterH1/TO (RNA PolIII)Available sinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.puro_shHuR 3UTR
Plasmid#110414PurposeTRCN0000276186 (Target TTGTTAGTGTACAACTCATTT), silence human ELAVL1 (HuR) gene, puromycin selectionDepositorInsertELAVL1 (HuR)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterU6 (RNA PolIII)Available sinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMSP2N2
Plasmid#29520DepositorInsertMSP2N2
UseTags7-His tagExpressionBacterialMutationtandem MSP; His-tag on N-terminus followed by spa…PromoterAvailable sinceMay 3, 2011AvailabilityAcademic Institutions and Nonprofits only -
pBAD24-sfGFPx2
Plasmid#51559PurposeSuperfolder GFP ORF cloned into pBAD24 for expression in E. coli. It contains additional aminoacids in the N and C terminus (polilinker sequences for cloning proteins in frame with GFP)DepositorInsertsuperfolder GFP
UseTagsGLESTCRHASLAVLADERRFSA and MARARAExpressionBacterialMutationContains additonal aa in the N and C terminus (in…PromoterAvailable sinceMarch 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
pFS462
Plasmid#89065Purposehis7 integration plasmid with Z3EVpr:GFPDepositorInsertZ3EV promoter GFP-NLS leu1 C-terminal 300 nt
UseS. pombe his7 integration vectorTagsExpressionMutationPromoterZ3EVAvailable sinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pBEAST_J23101-amidase
Plasmid#128135PurposeThe cell-free adapted backbone, pBEAST, expressing the amidase enzyme gene (benzamid to benzoate) under control of the constitutive promoter J23101, and RBS B0032DepositorInsertamidase
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterJ23101Available sinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only