We narrowed to 35,544 results for: IND
-
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pQCXIZ GFP PODXL delta PBM + Ezrin
Plasmid#202418PurposeExpression of GFP-tagged PODXL PDZ-binding motif mutation (PBM; doesn't bind NHERF1/2) fused to EZRINDepositorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOPINO_H3
Plasmid#171927PurposeBacterial expression of nanobody VHH_H3, which binds to receptor binding domain of the spike protein of SARS-CoV-2DepositorInsertVHH_H3
TagsHis6ExpressionBacterial and MammalianAvailable SinceSept. 23, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV.CAG.iAChSnFR-NULL
Plasmid#137956PurposeExpresses iAChSnFR (non-binding variant) under CAG promoterDepositorArticleInsertiAChSnFR (non-binding variant)
UseAAVExpressionMammalianMutationY140A binding site mutantPromoterCAGAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUltraHot-mCherry-BLM-WT
Plasmid#206966Purposeexpressing the protein BLM fused to mCherry in human cellsDepositorInsertBloom Syndrome RecQ Like Helicase (BLM Human)
UseLentiviralTagsmCherryExpressionMammalianAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ai14-HITI
Plasmid#87117PurposeAAV backbone plasmid including GFPNLS-pA knock-in donor and Ai14gRNA for HITIDepositorInsertU6-Ai14sgRNA-GFPNLS-EF1a-mCherryKASH-pA
UseAAV and CRISPRAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pOPINO_C5
Plasmid#171925PurposeBacterial expression of nanobody VHH_C5, which binds to receptor binding domain of the spike protein of SARS-CoV-2DepositorInsertVHH_C5
TagsHis6ExpressionBacterialAvailable SinceSept. 23, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCAGGS-FuG-C
Plasmid#67512PurposeThis is an envelope gene encoding plasmid to make retrogradely lentiviral vector. If you use this plasmid, you can make type C envelope coating virus particle with NeuRet.DepositorInsertFusion Glycoprotein type C
UseLentiviralTagsFusion protein of Vesicular stomatitis Indiana vi…PromoterCAGGSAvailable SinceJuly 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
pOPINO_C1
Plasmid#171924PurposeBacterial expression of nanobody VHH_C1, which binds to receptor binding domain of the spike protein of SARS-CoV-2DepositorInsertVHH_C1
TagsHis6ExpressionBacterialAvailable SinceSept. 23, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV.CAG-FLEX.iAChSnFR-Venus-NULL
Plasmid#137960PurposeExpresses FLEXed iAChSnFR (non-binding yellow version) under CAG promoterDepositorArticleInsertiAChSnFR (non-binding yellow variant)
UseAAV and Cre/LoxExpressionMammalianMutationY140A binding site mutationPromoterCAGAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pExp-RBD-CHis
Plasmid#195002PurposeProduction of SARS-CoV2 receptor binding domain in E. coli with C-terminal Avi-tagDepositorAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
FLAG-KIF5A tail only
Plasmid#166956PurposeExpresses FLAG-tagged KIF5A protein (820-1027aa) in pcDNA3.1DepositorAvailable SinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-rMERTK-HITI
Plasmid#87119PurposeGene correction donor AAV for RCS rat. AAV backbone plasmid including exon 2 of rat Mertk and rMertkgRNA for HITIDepositorInsertU6-rMertksgRNA-Mertk(intron1-2)-nEF-GFPKASH-pA
UseAAV and CRISPRAvailable SinceMarch 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pOPINO_F2
Plasmid#171926PurposeBacterial expression of nanobody VHH_F2, which binds to receptor binding domain of the spike protein of SARS-CoV-2DepositorInsertVHH_F2
TagsHis6ExpressionBacterial, Insect, and Mamm…Available SinceSept. 23, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
Cav2.1 HA EI,II,III,IVA (E320A, E670A, E1411A, E1707A) pcDNA3
Plasmid#206121Purposeexpression of rat Cav2.1 calcium channel with a E1686R mutation to enhance expression and a mutation in the P loop of Domains I, II, III and IV to to abolish divalent cation bindingDepositorInsertcacna1a (Cacna1a Rat)
ExpressionMammalianMutationE320A, E670A, E1411A, E1707APromoterCMVAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
R620-M06-303: CMV51p> TPAss-SARS-CoV-2 S-RBD(319-529)-3C-His8-SBP K417N/E484K/N501Y
Plasmid#170192PurposeMammalian expression of SARS-CoV-2 spike receptor-binding domain (RBD), triple mutant from B.1.351 variantDepositorInsertSARS-CoV-2 RBD (S SARS-CoV-2)
Tags3C-His8-SBPExpressionMammalianMutationK417N, E484K, N501YPromoterCMV51Available SinceMay 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
R620-M04-303: CMV51p> TPAss-SARS-CoV-2 S-RBD(318-529)-3C-His8-SBP N501Y
Plasmid#170190Purposeammalian expression of SARS-CoV-2 spike receptor-binding domain (RBD), N501Y mutant from B.1.1.7 variantDepositorInsertSARS-CoV-2 RBD (S SARS-CoV-2)
Tags3C-His8-SBPExpressionMammalianMutationN501YPromoterCMV51Available SinceMay 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSumo24P7vB4
Plasmid#113073PurposePlasmid for highly efficient expression of engineered IL24 with binding affinity to cognate receptorsDepositorInsertHuman IL-24 engineered by computational design and fused with N-terminal SUMO tag (IL24 Human, SUMO part (Brachypodium distachyon))
TagsSUMOExpressionBacterialMutationQ60R, K62E, K68E, K77R, M80L, S88D, A89V, Q93R, Q…PromoterT7Available SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSumo24P7
Plasmid#113072PurposePlasmid for highly efficient expression of engineered IL24 with mutated binding sitesDepositorInsertHuman IL-24 engineered by computational design and fused with N-terminal SUMO tag (IL24 Human, SUMO part (Brachypodium distachyon))
TagsSUMOExpressionBacterialMutationQ60R, K62E, K68E, K77R, M80L, S88D, A89V, Q93R, Q…PromoterT7Available SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ai14-luc
Plasmid#87118PurposeAAV backbone plasmid including luc-pA knock-in donor and Ai14gRNA for HITIDepositorInsertU6-Ai14sgRNA-Luciferase-nEF-GFPKASH-hGHpA
UseAAV, CRISPR, and LuciferaseAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only