We narrowed to 14,904 results for: TIM
-
Plasmid#48688Purpose3rd generation Lentiviral vector with bi-cistronic expression of dtomato and luciferaseDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceJune 16, 2014AvailabilityAcademic Institutions and Nonprofits only
-
PX458 eSp(1.1) V3
Plasmid#226963PurposeCBh-eSpCas9(1.1)-2A-GFP, and hU6-sgRNA (Sp) with a BbsI golden gate cloning backbone for sgRNA. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
PD2529 human beta1 full
Plasmid#221401PurposeMammalian expression of human integrin beta1 full-lengthDepositorInsertintegrin beta1 full-length (ITGB1 Human)
TagsCD33 secretion peptide (MPLLLLLPLLWAGALA) and HA …ExpressionMammalianMutationcodon-optimized mature sequenceAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMVA2RBS035
Plasmid#121051PurposeExpresses recombinant MVA pathway in Escherichia coliDepositorInsertsmvaE
mvaS
mvaK1
mvaK2
mvaD
idi
Available SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
hFLT1
Plasmid#83435Purposehuman VEGFR1 with HA and FLAG tagDepositorInserthuman VEGFR1 (FLT1 Human)
TagsFlag and MycExpressionMammalianMutationHA-tag was inserted 30 AA downstream of the FLT1 …PromoterCMVAvailable SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCAG_Xph20-GCaMP7f-CCR5TC
Plasmid#216534PurposeEncodes a specific PSD-95 binder (Xph20) fused to GCaMP7f, CCR5TC zinc finger, and KRAB(A) transcriptional repressor domainDepositorInsertXph20
TagsGCaMP7fExpressionMammalianPromoterCAGAvailable SinceMarch 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
PTK2 gRNA (BRDN0001146703)
Plasmid#75544Purpose3rd generation lentiviral gRNA plasmid targeting human PTK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-SFFV-Zim3-dCas9-BFP
Plasmid#188776PurposedCas9 with an N-term Zim3 KRAB-NLS fusion, a C-term HA-2xNLSDepositorInsertZim3-dCas9-mTagBFP2
UseLentiviralTagsHA-2xNLS-mTagBFP2 and Zim3 KRAB-NLS fusionPromoterSFFVAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
SaCas9v3-Puro
Plasmid#178813PurposeSaCas9 with 2A-Puro, and a cloning backbone for sgRNA. sgRNA scaffold seqeuence has been modified for increased sgRNA expression (v3).DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCbh (Cas9-2A Puro) and U6 (gRNA)Available SinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHR-SNAP-PDL1
Plasmid#223602PurposeLentiviral expression of human PD-L1 with SNAP tag in mammalian cellsDepositorAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE3G-XRI-FLAG
Plasmid#250671PurposeTimestamp monomer for encoding time along the CytoTape-vivo fiber for mouse brain in vivo applications.DepositorInsertXRI-FLAG
UseAAVExpressionMammalianPromoterTRE3GAvailable SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EGFP.T2A.NCLX
Plasmid#181873PurposeExpresses EGFP and murine NCLX (separated by a T2A cleavage site) under control of the synthetic CAG promoterDepositorInsertsUseAAV and AdenoviralTagsHA and mycExpressionMammalianPromotersynthetic hybrid CAG promoter and synthetic hybri…Available SinceMarch 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNMSB104
Plasmid#199314PurposeMosSCI insertion of flp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ChRmine::SL2::jRGECO1a::let-858 3'UTR at ttTi5605DepositorInsertflp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ChRmine::SL2::jRGECO1a::let-858 3'UTR
ExpressionWormMutationmTagBFP2 from pJJR81, C. elegans codon optimized …Promoterflp-18Available SinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGK-hMIGA2-DsRed
Plasmid#192867PurposeExpress codon-optimized human MIGA2 full length with a C-terminal DsRed tag in mammalian cellsDepositorInsertCodon-optimized human Mitoguardin 2 (MIGA2 Human)
TagsDsRedExpressionMammalianPromoterPGKAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR-CD86-SmBiT
Plasmid#223618PurposeLentiviral expression of human CD86 with SmBiT tag in mammalian cellsDepositorAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pH-nCas9-PPE-V2
Plasmid#170131PurposeFor plant prime editing in rice plants or monocotyledons protoplastsDepositorInsertnCas9(H840A)-M-MLV
UseCRISPRExpressionPlantMutationH840A for Cas9; D200N, T306K, W313F, T330P and L…Promotermaize Ubiquitin-1, OsU3Available SinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
DG SaCas9 GFP V3
Plasmid#226961PurposeCBh-SaCas9-2A-GFP, and 2X hU6-sgRNA (Sa) with BbsI golden gate cloning backbone for dual gRNAs. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIA33
Plasmid#120803PurposeE. coli-C. difficile shuttle vector for CRISPR interference (CRISPRi) in C. difficile; sgRNA targets rfp; Pxyl::dCas9-opt Pgdh::sgRNA-rfpDepositorInsertsdeactivated nuclease dCas9, codon-optimized for C. difficile
single guide RNA targeting red fluorescent protein
UseCRISPRExpressionBacterialMutationBase-pairing region targets red fluorescent prote…PromoterPgdh and PxylAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7 EGFPC2 TAZ
Plasmid#66850PurposeExpress GFP-fused TAZ by lentivirusDepositorAvailable SinceAug. 17, 2015AvailabilityAcademic Institutions and Nonprofits only