We narrowed to 7,386 results for: mag
-
Plasmid#196866PurposeExpression of the centrosomal protein Akna fused to enhanced (E)-GFPDepositorInsertAkna-mEGFP (Akna Mouse)
ExpressionMammalianPromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBactin-td-mCherry-Cdk5rap2
Plasmid#196859PurposeExpression of Cyclin dependent kinase 5 regulatory subunit-associated protein 2 (Cdk5rap2) fused to tandem (td)-mCherry.DepositorInserttd-mCherry-Cdk5rap2 (Cdk5rap2 Rat)
ExpressionMammalianPromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG1_CH2-3
Plasmid#105851PurposeExpression plasmid coding for hybrid heavy chain of mouse IgG1 antibody specific to antigen B of the ABO blood group system, clone M18. The antibody comprises IgG3-derived CH2.DepositorExpressionMammalianMutationhybrid heavy chain of mouse IgG1 with CH2 derived…PromoterhEF1-HTLV promAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG1_CH1h-3
Plasmid#105850PurposeExpression plasmid coding for hybrid heavy chain of mouse IgG1 antibody specific to antigen B of the ABO blood group system, clone M18. The antibody comprises IgG3-derived CH1 and hinge.DepositorExpressionMammalianMutationhybrid heavy chain of mouse IgG1 with CH1 and hin…PromoterhEF1-HTLV promAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHR-ZIP(FF)
Plasmid#27135DepositorUseLentiviralTagseGFP and mCherryExpressionMammalianMutationTyrosines in ITAMS 1-3 mutated to phenylalanines …Available SinceApril 12, 2011AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin I tension sensor (F40-based)
Plasmid#118725PurposeThe F40-based human desmoplakin I tension sensor detects forces in the range of 1-6 pN by changes in FRET between YPet(short) and mCherry.DepositorInserthuman Desmoplakin I-[YPet(short)-F40-mCherry] (internal-1952) (DSP Human)
UseRetroviralTagsYPet(short)-F40-mCherryExpressionMammalianMutationinserted F40-based tension sensor module after aa…PromoterCMVAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
Gal4 PGC1 alpha L2/3A
Plasmid#8898DepositorInsertPGC-1a (Ppargc1a Mouse)
TagsGal4 DBDExpressionMammalianMutationLXXLL at aa140 is changed to AXXLL; LLXXL at aa 2…Available SinceMay 24, 2006AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG1_h-3
Plasmid#105854PurposeExpression plasmid coding for hybrid heavy chain of mouse IgG1 antibody specific to antigen B of the ABO blood group system, clone M18. The antibody comprises IgG3-derived hinge.DepositorExpressionMammalianMutationhybrid heavy chain of mouse IgG1 with hinge deriv…PromoterhEF1-HTLV promAvailable SinceMarch 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II no force control (F40-based)
Plasmid#118716PurposeThe no force control for the F40-based human desmoplakin II tension sensor serves to detect changes in FRET between YPet(short) and mCherry that are tension-independent.DepositorInserthuman Desmoplakin II (1-1353)-[YPet(short)-F40-mCherry] (DSP Human)
UseRetroviralTagsYPet(short)-F40-mCherryExpressionMammalianMutationtruncation after aa1353PromoterCMVAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
Tom20-mChF-AIP(TD)
Plasmid#61521PurposeExpression of human FK506 binding protein 1A (FKBP1A) tagged with mCherry, Tom20, and AIP with TD mutationDepositorInsertFK506 binding protein 1A (FKBP1A Human)
TagsAIP with TD mutation (see comments), Tom20, and m…ExpressionMammalianMutationTD mutation (see comments)PromoterCMVAvailable SinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRRLNeo-pEF1a-p53ashL344P-mKate2-splitmVenusN
Plasmid#69586PurposeExpresses mutated p53-L344P tagged with mKate2 and split N-term mVenusDepositorInsertp53-L344P (TP53 Human)
UseLentiviralTagsmKate2 and split mVenus - N termExpressionMammalianMutationp53 L344P mutation that prevents dimerization and…PromoterEF1alphaAvailable SinceApril 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
mCerulean-DNAJC5
Plasmid#246730PurposeMammalian expression of human DNAJC5 wildtype with a mCerulean tag on its N-terminusDepositorInsertDNAJC5 (DnaJ heat shock protein family) (DNAJC5 Human)
TagsmCeruleanExpressionMammalianPromoterCMVAvailable SinceDec. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
mCerulean-DNAJC5 L115R
Plasmid#246732PurposeMammalian expression of human DNAJC5 L115R with a mCerulean tag on its N-terminusDepositorInsertDNAJC5 (DnaJ heat shock protein family) (DNAJC5 Human)
TagsmCeruleanExpressionMammalianMutationL115RPromoterCMVAvailable SinceDec. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
mCerulean-DNAJC5 delL116
Plasmid#246731PurposeMammalian expression of human DNAJC5 L116 deleted with a mCerulean tag on its N-terminusDepositorInsertDNAJC5 (DnaJ heat shock protein family) (DNAJC5 Human)
TagsmCeruleanExpressionMammalianMutationdelL116PromoterCMVAvailable SinceDec. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLEX307-RAD54L2-D1315-1467-SFB
Plasmid#247919PurposeMammalian expression construct for C-terminal S protein-Flag-Streptavidin binding peptide (SFB)-tagged RAD54L2 D1315-146DepositorInsertRAD54L2 (RAD54L2 Human)
UseLentiviralTagsS protein-Flag-Streptavidin binding peptide (SFB)ExpressionMammalianMutationdeletion of amino acid 1315-1467Available SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLEX307-RAD54L2-D87-291-SFB
Plasmid#247914PurposeMammalian expression construct for C-terminal S protein-Flag-Streptavidin binding peptide (SFB)-tagged RAD54L2 D87-29DepositorInsertRAD54L2 (RAD54L2 Human)
UseLentiviralTagsS protein-Flag-Streptavidin binding peptide (SFB)ExpressionMammalianMutationdeletion of amino acid 87-291Available SinceDec. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV6 FLAG-DNAJC5
Plasmid#246740PurposeMammalian expression of human DNAJC5 with L116 deleted, and a FLAG tag on its N-terminusDepositorInsertDNAJC5 (DnaJ heat shock protein family) (DNAJC5 Human)
TagsFLAGExpressionMammalianPromoterCMVAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF-1α-Venus-Nup107-FRT
Plasmid#247344PurposeExpresses Venus-NUP107 under EF1 promoter and can be integrated into FRT siteDepositorAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE-dCas9(sa)-VP64-AAV
Plasmid#213035PurposedCas9-VP64 expressed under control of TREDepositorInsertdCas9
UseAAV and CRISPRTagsNLS and NLS-VP64PromoterTRE, miniCMVAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only