We narrowed to 7,549 results for: mag
-
Plasmid#242593PurposeA Tol2 expression vector containing the zebrafish Ubi promoter driving zFUCCI to label cell cycle state. Exorh-EGFP in the backbone to label pineal cells.DepositorInsertmCerulean-zGeminin, mCherry-zCdt1
UseZebrafish expressioPromoterzebrafish UbiAvailable SinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLVX-ATF4 mScarlet NLS
Plasmid#115969PurposeER-stress sensor - ATF4 translation at ORF3 fluorescent reporter with mScarlet-IDepositorInsertactivating transcription factor 4 (ATF4 Synthetic, Human)
UseLentiviralTagsHA tag, c-myc NLS, and mScarlet-IExpressionMammalianPromoterCMVAvailable SinceSept. 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV TRE3G Neo GFP-Progerin
Plasmid#118710PurposeLentiviral TET-ON inducible GFP-ProgerinDepositorInsertGFP-Progerin (LMNA Human)
UseLentiviral; Tet-on inducibleTagsGFPExpressionMammalianPromoterCMV TRE3G (TET-ON)Available SinceNov. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNK497
Plasmid#219754PurposeMoClo-compatible Level P vector for improved autonomous bioluminescence in plants encoding kanamycin resistance cassette, nnHispS, NpgA, nnH3H_v2, nnLuz_v4 and nnCPH.DepositorInsertnnHispS, NpgA, nnH3H_v2, nnLuz_v4 and nnCPH
ExpressionPlantAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-GCN5
Plasmid#65386PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET-28a(+)-FGF2-G3
Plasmid#135521PurposeEngineered form of fibroblast growth factor 2 with improved thermostabilityDepositorInsertfibroblast growth factor 2 (FGF2 Human)
Tags6x His tag and Agg Thrombin TagExpressionBacterialMutationCodon optimized for E. Coli productionPromoterT7 PromoterAvailable SinceJan. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET-32a(+)-TGFB1
Plasmid#120361PurposeProduce human recombinant TGFB1 in DE3 cellsDepositorInsertTransforming Growth Factor-β1 (TGFB1 Synthetic, Human)
Tags6x His and S-TagExpressionBacterialMutationCodon optimized for E. Coli productionPromoterT7 PromoterAvailable SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEF-1α-Venus-Nup107-FRT
Plasmid#247344PurposeExpresses Venus-NUP107 under EF1 promoter and can be integrated into FRT siteDepositorAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
24xMoonTag-kif18b-STOP-24xSunTag-linker-24xPP7 (3’UTR translation reporter)
Plasmid#128605PurposeExpresses 24xgp41 peptide array (MoonTag peptide array), followed by kif18b gene, STOP codon, 24xgcn4 peptide array (SunTag peptide array), linker and 24 repeats of PP7 hairpins.DepositorInsertsExpressionMammalianPromoterPcmvAvailable SinceJan. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/T0-Flag-BRIP1
Plasmid#222619PurposeMammalian expression vector of flag-tagged BRIP1DepositorAvailable SinceJuly 25, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
AAV Syn-FLEX-coca-5HT3-IRES-mCherry
Plasmid#242195PurposeCre-dependent AAV vector for cocaine-gated chemogenetic cation channelDepositorInsertSyn-FLEX-coca-5HT3-IRES-mCherry (Htr3a Mouse)
UseAAVExpressionMammalianMutationL141G G175K Y210F Y217FPromoterSynapsinAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-BRD2
Plasmid#65376PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceMay 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET-32a(+)-TGFB3
Plasmid#120288PurposeProduce human recombinant TGFB3 in DE3 cellsDepositorInsertTransforming Growth Factor-β3 (TGFB3 Synthetic, Human)
Tags6x His and S-TagExpressionBacterialMutationCodon optimized for E. Coli productionPromoterT7 promoterAvailable SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGP-CMV-jGCaMP7f
Plasmid#104483PurposeMammalian expression of ultrasensitive protein calcium sensorDepositorInsertjGCaMP7f
TagsT7 epitope, Xpress tag, 6xHisExpressionMammalianPromoterCMVAvailable SinceDec. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-NES-FRCaMPi-P2A-mGreenLantern
Plasmid#232841PurposeAAV transfer plasmid for CAG-mediated co-expression of FRCaMPi and mGreenLanternDepositorInsertNES-FRCaMPi
UseAAVTagsnuclear export sequenceExpressionMammalianPromoterCAGAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-BAZ1B
Plasmid#65372PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRSET OCaMP
Plasmid#224932PurposeExpresses OCaMP, an orange calcium indicator, in bacteria. Contains T7 promoter and RSET leader sequence peptide (His tag, T7 leader, Xpress epitope)DepositorInsertOCaMP
Tags6xHis, RSET peptide, and Xpress tagExpressionBacterialPromoterT7Available SinceJuly 28, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTubb3-MC
Plasmid#87112Purposeminicircle parental backbone plasmid including GFP knock-in donor targeting Tubb3 gene and one cutting site for HITIDepositorInsertGFP
UseCRISPRAvailable SinceMarch 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
5xUAS:GAP-EGFP-P2A-NfsB_Vv F70A/F108Y,he:tagBFP2
Plasmid#158652Purposemaking transgenics expressing a UAS driven eGFP and NTR 2.0DepositorInsert5xUAS:GAP-eGFP-P2A-NfsB_Vv F70A/F108Y;he:BFP
UseTol2-based transgenic expression in zebrafish/oth…MutationF70A/F108YAvailable SinceSept. 14, 2020AvailabilityAcademic Institutions and Nonprofits only