We narrowed to 6,397 results for: kit
-
Plasmid#1649DepositorTypeEmpty backboneUseRNAiTagsT7p, gfpC, gfpS65S, gfpN, T7p, lacZN, OriF1>&g…ExpressionWormAvailable sinceMarch 7, 2005AvailabilityAcademic Institutions and Nonprofits onlyCited by
-
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available sinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCS2TAL3-DD
Plasmid#37275PurposeTALEN backbone vector for use with the Golden Gate TALEN Kit in place of pTAL1-4. Shorter N- and C-terminal tal protein segments increases mutation induction; Fok I DD (improved version=pCS2TAL3-DDD)DepositorTypeEmpty backboneTagsFlag, Fok I DD, Tal-C, and Tal-NExpressionBacterial and MammalianPromoterCMVAvailable sinceJune 27, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCS2TAL3-RR
Plasmid#37276PurposeTALEN backbone vector for use with the Golden Gate TALEN Kit in place of pTAL1-4. Shorter N- and C-term tal protein segments increases mutation induction; Fok I RR (improved version = pCS2TAL3-RRR)DepositorTypeEmpty backboneTagsC terminal Tal From pTAL3, FokI RR, HA, and N-ter…ExpressionBacterial and MammalianPromoterCMVAvailable sinceJune 27, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
SI14-Kit b
Plasmid#46304DepositorAvailable sinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-LOC652799
Plasmid#23394DepositorAvailable sinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SEP-GluA1 TKIT
Plasmid#169441PurposeExpression of 2 guides + donor DNADepositorInsertSuper ecliptic pHluorin (SEP)
UseAAV and CRISPRAvailable sinceJune 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SEP-GluA2 TKIT
Plasmid#169442PurposeExpression of 2 guides + donor DNADepositorInsertSuper ecliptic pHluorin (SEP)
UseAAV and CRISPRAvailable sinceJune 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available sinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHyg-AID*-6HA
Plasmid#99520PurposeC-terminal AID*-6HA degron cassette with HygR marker for S. cerevisiaeDepositorAvailable sinceSept. 14, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pKan-AID*-9myc
Plasmid#99522PurposeC-terminal AID*-9myc degron cassette with KanR marker for S. cerevisiaeDepositorAvailable sinceSept. 14, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSBbi G418R mbIL21
Plasmid#194329PurposeConsitiutive mammalian expression of membrane bound human IL-21DepositorAvailable sinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pVITRO1-Trastuzumab-IgG2/κ
Plasmid#61884PurposeExpresses HER2/neu receptor specific humanized IgG2/κ antibody isotype (Trastuzumab-IgG2/κ)DepositorInsertsHER2/neu receptor specific humanized Gamma 2 heavy chain expression cassette
HER2/neu receptor specific humanized kappa light chain expression cassette
ExpressionMammalianPromotermEF1 Prom and rEF1 PromAvailable sinceMarch 17, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pVITRO1-Trastuzumab-IgG3/κ
Plasmid#61885PurposeExpresses HER2/neu receptor specific humanized IgG3/κ antibody isotype (Trastuzumab-IgG3/κ)DepositorInsertsHER2/neu receptor specific humanized Gamma 3 heavy chain expression cassette
HER2/neu receptor specific humanized kappa light chain expression cassette
ExpressionMammalianPromotermEF1 Prom and rEF1 PromAvailable sinceMarch 17, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pVITRO1-dV-IgG1/λ
Plasmid#52214PurposeHuman immunoglobulin gamma 1 antibody expression vector (lambda light chain) without variable regions. Enables Colony-PCR screening of false-positive (PCR vector template) coloniesDepositorInsertsHuman immunoglobulin gamma 1 constant region
Human immunoglobulin lambda constant region
ExpressionMammalianMutationDeleted Variable regionPromoterMouse Elongation Factor 1 Alpha and Rat Elongatio…Available sinceApril 1, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pVITRO1-Trastuzumab-IgM/κ
Plasmid#61881PurposeExpresses HER2/neu receptor specific humanized IgM/κ antibody isotype (Trastuzumab-IgM/κ)DepositorInsertsHER2/neu receptor specific humanized Mu heavy chain expression cassette
HER2/neu receptor specific humanized kappa light chain expression cassette
ExpressionMammalianPromotermEF1 Prom and rEF1 PromAvailable sinceMarch 17, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pVITRO1-102.1F10-IgG1/λ
Plasmid#50366PurposeExpresses grass pollen allergen Phl p 7 specific human IgG1/λ antibody isotype (102.1F10-IgG1/λ)DepositorInsertsgrass pollen allergen Phl p 7 specific human Gamma 1 heavy chain expression cassette
grass pollen allergen Phl p 7 specific human lambda light chain expression cassette
ExpressionMammalianPromoterMouse Elongation Factor 1 Alpha and Rat Elongatio…Available sinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Golden Gate TALEN and TAL effector kit 2.0
Plasmid kit#1000000024PurposeAssemble TALEN constructs with custom repeat arrays between 12 and 31 repeats via Golden Gate cloning for expression in multiple systems.DepositorApplicationCloning and Synthetic Biology, Genome EditingVector typeMammalian Expression, Plant Expression, Yeast ExpressionEditing typeTALENCloning typeGolden GateAvailable sinceJan. 8, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pVITRO1-M80-F2-IgG1/κ
Plasmid#50383PurposeExpresses human IgG1/κ antibody isotype with unknown specificity. Useful vector for cloning of human antibodies with kappa light chainDepositorInsertshuman Gamma 1 heavy chain expression cassette with unknown specificity
human Kappa light chain expression cassette with unknown specificity
ExpressionMammalianPromoterMouse Elongation Factor 1 Alpha and Rat Elongatio…Available sinceJan. 27, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
GoldenBraid 2.0 Kit
Plasmid kit#1000000076PurposePlant synthetic biology kit for GoldenBraid cloning and multigene engineering, including CRISPR/Cas9 parts.DepositorApplicationCloning and Synthetic Biology, Genome EditingVector typePlant ExpressionEditing typeCRISPRCloning typeGolden Gate (GoldenBraid)Available sinceMarch 16, 2016AvailabilityAcademic Institutions and Nonprofits only