We narrowed to 4,533 results for: Gaa
-
Plasmid#68255PurposeLevel 1 Golden Gate Cassette: sgRNA cassette targeting BolC.GA4a-1 in Brassica oleraceaDepositorInsertPromoter_AtU6-26 + sgRNA_BolC.GA4a-1
UseSynthetic BiologyExpressionPlantAvailable SinceAug. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pICSL11058
Plasmid#68254PurposeLevel 1 Golden Gate Cassette: sgRNA cassette targeting PM19_3 in barleyDepositorInsertPromoter_TaU6 + sgRNA_HvPM19_3
UseSynthetic BiologyExpressionPlantAvailable SinceAug. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Rabep1 shRNA 369958-CMV-TurboGFP
Plasmid#254777PurposeRabep1 shRNA 369958 in pLKO backboneDepositorAvailable SinceMay 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti_DualsgRNA_TIMM23_Puro_T2A_BFP2
Plasmid#236731PurposeDual sgRNA targeting TIMM23 expressing BFP with Puromycin selectionDepositorInsertTIMM23 (TIMM23 Human)
UseLentiviralAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti_DualsgRNA_TIMM23_ER-dAPEX-BFP2
Plasmid#236734PurposeDual sgRNA targeting TIMM23 expressing dAPEX-BFP targeting to ERDepositorInsertTIMM23 (TIMM23 Human)
UseCRISPR and LentiviralAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
EDCPV PCSK5_sg09
Plasmid#232455PurposeLentiviral, CRISPR sgRNA for PCSK5DepositorInsertPCSK5 sgRNA (PCSK5 Human)
UseCRISPR and LentiviralAvailable SinceNov. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs-RPPH1 (pAVA3585)
Plasmid#239262PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting RPPH1DepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting RPPH1
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-GFP
Plasmid#238041PurposeEncodes sfGFP under lac promoter. Expresses a single guide RNA (under Rha promoter), which targets a noncoding region of the plasmid as part of the ADEPT system. Carries oriT and kan resistance.DepositorInsertsfGFP
UseSynthetic BiologyPromoterlacAvailable SinceJune 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-RFP
Plasmid#238040PurposeEncodes mRFP1 under pLux promoter. Expresses a single guide RNA (under Ara promoter), which targets a noncoding region of the plasmid as part of the ADEPT system. Carries oriT and kan resistance.DepositorInsertmRFP1
UseSynthetic BiologyPromoterLuxAvailable SinceJune 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
BoxB-MS2 adRNA (RAB7A-GAC site)
Plasmid#170149PurposeAAV vector carrying a BoxB-MS2 adRNA targeting the RAB7A transcriptDepositorInsertBoxB-RAB7A(GAC)-MS2
UseAAVExpressionMammalianPromoterHuman U6Available SinceAug. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-MFN1-GFP
Plasmid#221846PurposeTol2 transposon expressing sgRNA targeting chick MFN1 from chick U6.3 promoter expresses GFP reporter from GAGC promoteDepositorInsertsEGFP
MFN1 sgRNA-GAGAAGAAGAGCGTCAAGGT
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterCAGC and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13250
Plasmid#219921PurposeThe base plasmid of TUNEYALI for TF60DepositorInsertContains gRNA targeting TF60 (YALI1_B16239g) and homologous arm matching TF60
ExpressionYeastAvailable SinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13235
Plasmid#219908PurposeThe base plasmid of TUNEYALI for TF45DepositorInsertContains gRNA targeting TF45 ( YALI1_B23373g) and homologous arm matching TF45
ExpressionYeastAvailable SinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1- sgCTG Gollum-eCMV-SaSpD10A (Neuron codon optimization)-3XFLAG-SV40 NLS-ITR2
Plasmid#210735PurposeCoding for SaSp D10A Cas9 alongside Gollum sgRNA targeting CAG repeatsDepositorInsertsSaSp D10A Cas9
Gollum sgCAG
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationD10A, N terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable SinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
HSF2 KO
Plasmid#200208PurposegRNA for HSF2 KODepositorAvailable SinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDGO186N-KS1
Plasmid#174301PurposeReplicating plasmid with sgRNA cassette containing a killing spacer #1 targeting the wild type polC gene.DepositorInsertspacer expression cassette
ExpressionBacterialAvailable SinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDGO186N-KS2
Plasmid#174302PurposeReplicating plasmid with sgRNA cassette containing a killing spacer #2 targeting the wild type polC gene.DepositorInsertspacer expression cassette
ExpressionBacterialAvailable SinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSCL.111
Plasmid#184980PurposeTest effect of extending a1/a2 on TRP2 editing rates in yeastDepositorInsertEco1 editing ncRNA and gRNA, TRP2 E64X, a1/a2 length: 27 v1
ExpressionYeastMutationTRP2 donor E64stop, a1/a2 length extended to 27 bpPromoterGal7Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.110
Plasmid#184979PurposeExpress -Eco1 TRP2 editing ncRNA and gRNADepositorInsertEco1 editing ncRNA and gRNA, TRP2 E64X, a1/a2 length: 12
ExpressionYeastMutationTRP2 donor E64stopPromoterGal7Available SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
double_sgRNA targeting e1 and e4
Plasmid#190688PurposesgRNAs targeting enhancer 1 and 4 of MYC separatelyDepositorInsertsgRNAs targeting enhancer 1 and 4 of MYC separately
UseCRISPR, Lentiviral, and Synthetic BiologyTagsBFP and PuromycinExpressionMammalianAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT004
Plasmid#182714PurposeConstituitvely expressed CasRx crRNA cloning vector, extended 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056H
Plasmid#183135PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii sxl, and 1 gRNA targeting D.suzukii bTub,Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[sxl, bTub]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFB_ROSA26_SpCas9_gRNAs
Plasmid#174703PurposePlasmid containing separate SpCas9 gRNAs for targeted excision of inserted STOP Cassette upstream of reporter alleles found in Ai14 and Ai6 mice. ITRs flank the cassette for easy vector creation.DepositorInsertSpCas9 dual gRNAs
UseAAVAvailable SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDR-itga9_sgRNA1
Plasmid#132979Purposeitga9 sgRNA targeting to "5'-GAATGACGGAGCTCTCTACG-3" in pDR274DepositorInsertitga9 sgRNA1 target sequence
UseCRISPR; Sgrna generation vectorAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTBL322 GC
Plasmid#126950PurposeTo target a protospacer with GC at the cut site.DepositorInsertspacer against human genome with GC at cut site
ExpressionMammalianPromoterhuman U6Available SinceMay 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
gRNA[Tra].1026G
Plasmid#112689Purposeexpress gRNA targeting Tra under dU6-3 promoterDepositorInsertU6.3-gRNA[Tra] (tra Fly)
UseCRISPRAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
-