We narrowed to 7,609 results for: trac
-
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pLKO_AU1.C.NWS_mCherry-NLS
Plasmid#178282PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.C.NWS and Nuclear Localization SignalPromotereF1aAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28a-GST-BTLAicd (AA190-289, Y257F, Y282F)-TwinStrep
Plasmid#180811PurposeExpression of GST fused human BTLA intracellular domain (AA190-289, Y257F, Y282F)-TwinStrepDepositorInsertGST-BTLAint (AA190-289, Y257F, Y282F)-TwinStrep (BTLA Human)
ExpressionBacterialMutationBTLA (Y257F, Y282F)PromoterT7Available SinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.S.V5_mCherry-NLS
Plasmid#178281PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsNWS.S.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.Ollas.V5_mCherry-NLS
Plasmid#178280PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsNWS.Ollas.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.NWS.V5_mCherry-NLS
Plasmid#178275PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHSV.NWS.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.NWS.VSVg_mCherry-NLS
Plasmid#178274PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHSV.NWS.VSVg and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.NWS.Ollas_mCherry-NLS
Plasmid#178272PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHSV.NWS.Ollas and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.VSVg.V5_mCherry-NLS
Plasmid#178271PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.VSVg.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.S.V5_mCherry-NLS
Plasmid#178270PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.S.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.Ollas.V5_mCherry-NLS
Plasmid#178268PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.Ollas.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.Ollas.VSVg_mCherry-NLS
Plasmid#178267PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.Ollas.VSVg and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.Ollas.S_mCherry-NLS
Plasmid#178266PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.Ollas.S and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.NWS.VSVg_mCherry-NLS
Plasmid#178265PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.NWS.VSVg and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.NWS.S_mCherry-NLS
Plasmid#178264PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.NWS.S and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.HSV.V5_mCherry-NLS
Plasmid#178262PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.HSV.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.VSVg.V5_mCherry-NLS
Plasmid#178257PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.VSVg.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.S.V5_mCherry-NLS
Plasmid#178256PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.S.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.Ollas.V5_mCherry-NLS
Plasmid#178254PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.Ollas.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.Ollas.VSVg_mCherry-NLS
Plasmid#178253PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.Ollas.VSVg and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only