We narrowed to 14,179 results for: CRISPR-Cas9
-
Plasmid#46294PurposeA codon-optimized Cas9 nuclease under the control of the Drosophila hsp70 promoter.DepositorInsertcodon optimized Cas9
UseCRISPRTags3x FlagExpressionInsectMutationSilent change from C to A at bp 834 of insertPromoterHsp70Available SinceJuly 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pRubiG-T2A-Cas9
Plasmid#75348PurposeUbiquitin promoter expresses GFP and humanized spCas9 (PX330) via a T2A motif. For cell transfection or use in retroviral (MMuLV) packaging. Use Pac1 and/or BstB1 sites to insert sgRNAs from PXL.DepositorInsertCas9
UseCRISPR and RetroviralTagsGFP (via t2a)ExpressionMammalianPromoterUbiquitinAvailable SinceMay 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRubiC-T2A-Cas9
Plasmid#75347PurposeUbiquitin promoter expresses mCherry and humanized spCas9 (PX330) via a T2A motif. For cell transfection or use in retroviral (MMuLV) packaging. Use Pac1 and/or BstB1 sites to insert sgRNAs from PXL.DepositorInsertCas9
UseCRISPR and RetroviralTagsmCherry (via t2a)ExpressionMammalianPromoterUbiquitinAvailable SinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
SpRY dCas9 VPR
Plasmid#188511PurposeExpresses FLAG tagged SpRY dCas9 VPRDepositorInsertdCas9
UseCRISPR and LentiviralExpressionMammalianMutationD10A/A61R/H840A/L1111R/D1135L/S1136W/G1218K/E1219…PromoterEF1aAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC91-pmax-dCas9VP64
Plasmid#48223PurposedCas9VP64 on pmax expression vectorDepositorInsertdCas9(D10A;H840A) fusion with VP64 activation domain
UseCRISPRTagsHA Tag and VP64ExpressionMammalianMutationD10A;H840A (catalytically inactive)PromoterCAGGSAvailable SinceSept. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-dpcoCas9-SunTag
Plasmid#158410PurposeCRISPR-dpcoCas9 fused with SunTag recruiting VP64 activators for transcriptional activationDepositorInsertdpcoCas9-SunTag-rbcS-E9t-ter-ZmUbi-scFv-sfGFP-VP64-GB1-NOS-ter
UseCRISPRExpressionPlantAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
FUG-T2A-Cas9
Plasmid#75346PurposeUbiquitin promoter expresses GFP and humanized spCas9 (from PX330) via a T2A motif. For cell transfection or use in lentiviral packaging. Use Pac1 and/or BstB1 sites to insert sgRNAs from PXL.DepositorInsertCas9
UseCRISPR and LentiviralTagsGFP (via t2a)ExpressionMammalianPromoterUbiquitinAvailable SinceMay 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAC92-pmax-dCas9VP96
Plasmid#48224PurposedCas9VP96 on pmax expression vectorDepositorInsertdCas9(D10A;H840A) fusion with VP96 activation domain
UseCRISPRTagsHA Tag and VP96ExpressionMammalianMutationD10A;H840APromoterCAGGSAvailable SinceSept. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLVNP2.0-SpCas9
Plasmid#206880PurposeExpresses FLAG-tagged SpCas9 fused to the N-terminus of Gag/GagPol harbouring an intervening phospholipase C-δ1 pleckstrin homology (PH) domainDepositorAvailable SinceOct. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330-SpCas9-NG
Plasmid#117919PurposeExpresses 3xFLAG-NLS-SpCas9-NG-NLS in mammalian cells.DepositorInsertSpCas9-NG (L1111R/D1135V/G1218R/E1219F/A1322R/R1335V/T1337R)
ExpressionMammalianAvailable SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO5d.EFS.SpCas9.P2A.BSD
Plasmid#57821PurposeLentiviral Vector for SpCas9 Expression without sgRNA, Blasticidin resistance, EFS Promoter drivenDepositorAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
Cas9/pTREX-n
Plasmid#68708PurposeExpresses the fusion gene CAS9-HA-2xNLS-GFP in the pTREX-n backbone. This vector is used for cloning a specific sgRNA by BamHI, to be co-expressed with Cas9 for genome editing in Trypanosoma cruzi.DepositorInsertFusion gene Cas9-HA-2xNLS-GFP from vector pMJ920 (Addgene) .
UseCRISPRTagsFusion gene Cas9-HA-2xNLS-GFP from vector pMJ920 …MutationC4239T mutation that eliminates a BamHI restricti…Available SinceSept. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO5d.EFS.SpCas9.P2A.PAC
Plasmid#58329PurposeLentiviral Vector for SpCas9 Expression without sgRNA, Puromycin resistance, EFS Promoter drivenDepositorAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pX551-CMV-SpCas9
Plasmid#107024PurposeAAV plasmid expressing Cas9 under control of CMV promoter, by replaceing mecp2 promoter in pX551 from Zhang labDepositorInsertSpCas9
UseAAV and CRISPRExpressionMammalianAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLex_Cas9
Plasmid#117987PurposepLex_Cas9 is a single insert lentiviral vector expressing Cas9 driven by CMV promoter.DepositorInsertCas9-P2A-NLS-BASTR
UseLentiviralTagsP2A linker, nuclear localization signal and blast…Available SinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA NC
Plasmid#176259PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and spacer sequence on sgRNA is replaced by the type IIS restriction site for endonuclease BaeI andDepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseMutationH840A and D10A mutations on spCas9 to inactivate …Available SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti_Cas9_GFP_AAVS1_sg1
Plasmid#254529PurposeAAVS1 knockout, control guideDepositorInsertAAVS1
UseCRISPR and LentiviralTagsFLAG-SV40NLS and nucleoplasminNLS-P2A-GFPAvailable SinceMay 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti_Cas9_GFP_AAVS1_sg2
Plasmid#254530PurposeAAVS1 knockout, control guideDepositorInsertAAVS1
UseCRISPR and LentiviralTagsFLAG-SV40NLS and nucleoplasminNLS-P2A-GFPAvailable SinceMay 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti_Cas9_GFP_AAVS1_sg3
Plasmid#254531PurposeAAVS1 knockout, control guideDepositorInsertAAVS1
UseCRISPR and LentiviralTagsFLAG-SV40NLS and nucleoplasminNLS-P2A-GFPAvailable SinceMay 11, 2026AvailabilityAcademic Institutions and Nonprofits only