We narrowed to 45,376 results for: Ina
-
Plasmid#90239PurposeLentiviral vector to express JNK KTR EE (mutant) mClover under PGK promoter (With Puromycin Resistance)DepositorInsertJNK Kinase Translocation Reporter (EE mutant)
UseLentiviralTagsmCloverExpressionMammalianPromoterPGKAvailable SinceMarch 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
Unc5b.a-Fc-His
Plasmid#72178PurposeExpresses the extracellular region of the Unc5B, isoform a protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pVL1393-MAL-SYK
Plasmid#157990PurposeExpresses SYK in insect cell (sf9)DepositorInsertSpleen tyrosine kinase (SYK Human)
TagsMet-Ala-Leu and add Leu,Glu residues +His tagExpressionInsectAvailable SinceAug. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-(STChRger2-TS-EYFP)
Plasmid#129394PurposeSoma Targeted, High photocurrent, low-light sensitive channelrhodopsin (ChRger2) for optogenetic activation with systemic delivery or for low-light activation. Uses the CAG promoter and double floxed.DepositorInsertsoma targeted ChRger2
UseAAV and Cre/LoxTagsKv2.1-TS-EYFPExpressionMammalianPromoterCAGAvailable SinceOct. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
Sema3a(S)-Fc-His
Plasmid#72138PurposeExpresses the Sema3A protein (truncated at cleavage site P1; ie, short), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5 TEX264wt-cSSH
Plasmid#220209PurposeMammalian expression of wild type TEX264, C-terminal twin-Strep_HA tagDepositorAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DYRK2-2A-mCherry
Plasmid#118285PurposeExpresses mouse DYRK2 tagged with 2A peptide at it's C-terminus and mCherry in mammalian cells.DepositorInsertdual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 (Dyrk2 Mouse)
UseAAVTags2A peptide and mCherryExpressionMammalianPromoterCMV with beta global intronAvailable SinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
Nrp2.3-AP-His
Plasmid#71974PurposeExpresses the extracellular region of the Neuropilin 2, isoform 3 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET32a-hBTC
Plasmid#199230PurposeBacterial production of soluble, active target proteins; Nterm thrombin and enterokinase cleavage sites.DepositorAvailable SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
Sema3a(L, del3)-Fc-His
Plasmid#72136PurposeExpresses the Sema3A protein (truncated at cleavage site P3; ie, long and missing exon 3), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DYRK3-2A-mCherry
Plasmid#118287PurposeExpresses mouse DYRK3 tagged with 2A peptide at it's C-terminus and mCherry in mammalian cells.DepositorInsertdual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3 (Dyrk3 Mouse)
UseAAVTags2A peptide and mCherryExpressionMammalianPromoterCMV with beta global intronAvailable SinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
Ntng2.b-AP-His
Plasmid#71995PurposeExpresses the extracellular region of the Netrin G2, isoform b protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET-deSpCas9-VP64-6xHis
Plasmid#92117PurposeExpression of dead/inactive increased fidelity eSpCas9 (1.1)-VP64-6xHis in bacterial cellsDepositorInsertdead/inactive eSpCas9-NLS-3xFLAG-VP64
UseCRISPRTags3xFLAG, 6xHis, NLS, and VP64ExpressionBacterialMutationD10A, H840A, K848A, K1003A, R1060APromoterT7Available SinceOct. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
BMR1_01g02031-bio-His
Plasmid#108116Purpose[Edit] Expresses enzymatically monobiotinylated full-length BMR1_01g02031 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tagDepositorInsertBMR1_01g02031
TagsratCD4d3+4,biotinylation sequence, 6xHisExpressionMammalianMutationall potential N-linked glycosylation sites (N-X-S…PromoterCMVAvailable SinceOct. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
HA-PRAS40 AA
Plasmid#86759PurposeN-terminal HA-tagged protein expression in mammalian cellsDepositorInserthuman PRAS40 (AKT1S1 Human)
TagsHAExpressionMammalianMutationAA (S183A, S221A)PromoterCMVAvailable SinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
Neo1.a-Fc-His
Plasmid#72089PurposeExpresses the extracellular region of the Neogenin 1, isoform a protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
Sema5a-Fc-His
Plasmid#72161PurposeExpresses the extracellular region of the Sema5A protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ntng1.a-AP-His
Plasmid#71984PurposeExpresses the extracellular region of the Netrin G1, isoform a protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV5 Flag-Smad1 (4SP/AP+AAVA)
Plasmid#14955DepositorInsertSmad1 (4SP/AP+AAVA) (SMAD1 Human)
TagsFlagExpressionMammalianMutationFour Serine to Alanine mutations in the linker re…Available SinceMay 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
pET28a-baPrs-hdNadV
Plasmid#91950PurposepET28a-baPrs-hdNadV is a bicistronic vector designed for the simultaneous expression of PRS from Bacillus amyloliquefaciens and NadV from Haemophilus ducreyiDepositorInsertsPutative Nicotinamide Phosphoribosyl Transferase (nadV Haemophilus ducreyi, strain: ATCC 27722)
Phosphoribosyl Pyrophosphate Synthetases
ExpressionBacterialMutationchanged Leucine 135 to IsoleucinePromoterT7Available SinceSept. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-tdTomato-f
Plasmid#127092PurposeAn AAV genome with tet-inducible, Cre-dependent expression of farnesylated (f) tdTomatoDepositorInserttdTomato-f
UseAAVTagsfarnesylation signal from c-Ha-RasExpressionMammalianAvailable SinceJune 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
MSP10-bio
Plasmid#47719PurposeExpresses enzymatically monobiotinylated full-length MSP10 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised MSP10
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 GW-mCit-PA
Plasmid#113449PurposeProteinA-mCitrine Gateway shuttle vector for C-terminal fusionsDepositorTypeEmpty backboneUseGateway shuttle vectorTagsmCitrine-ProteinAExpressionMammalianPromoterCMVAvailable SinceAug. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
FusionRed-Dectin1A-C-10
Plasmid#56111PurposeLocalization: Membrane, Excitation: 580, Emission: 608DepositorAvailable SinceApril 1, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
GFP-IP3KC
Plasmid#134603PurposeExpresses IP3KC GFP taggedDepositorAvailable SinceNov. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA Myc-mMEKK2
Plasmid#44158DepositorAvailable SinceApril 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
MTRAP-bio
Plasmid#68530PurposeExpresses full-length P. vivax MTRAP ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequenceDepositorInsertMTRAP
Tagsrat CD4 d3+4, enzymatic biotinylation sequenceExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceSept. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET-pro-siRNA-V2-TP53
Plasmid#111089PurposepET-pro-siRNA-V2 based plasmid for production of recombinant siRNAs (pro-siRNAs) against human TP53 gene.DepositorInsertTP53 (TP53 Human)
ExpressionBacterialAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
VIPR1
Plasmid#51865PurposeExpresses full-length Vasoactive intestinal polypeptide receptor 1 precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertVIPR1 (VIPR1 Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only