We narrowed to 10,063 results for: CAG
-
Plasmid#100815PurposeLentiviral vector expressing a doxycycline-inducible short hairpin RNA against CUX1 sequence starting at 5328 of M74099DepositorInsertTGCTGTTGACAGTGAGCGTCTTCTCGTTTGAAACTTTGAATAGTGAAGCCA
UseLentiviralExpressionMammalianAvailable sinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
hgRNA-A101_pLKO-Hyg
Plasmid#100569PurposehgRNA-A101 in a lentiviral backboneDepositorInserthgRNA-A101
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianAvailable sinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
hgRNA-A26_pLKO-Hyg
Plasmid#100566PurposehgRNA-A26 in a lentiviral backboneDepositorInserthgRNA-A26
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianAvailable sinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTC365
Plasmid#91214Purposeprotoplast vector expressing 2 gRNAs targeting tomato ARF8A (CmYLCV promoter, tRNA processing)DepositorInsert2 gRNAs targeting tomato ARF8A
UseCRISPRExpressionPlantAvailable sinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFP59
Plasmid#247215PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available sinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
RET gRNA (BRDN0001149257)
Plasmid#77499Purpose3rd generation lentiviral gRNA plasmid targeting human RETDepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAV hTERTsh
Plasmid#111380PurposeKnock down of hTERT transcriptDepositorInsertshRNA C3 against hTERT
UseAdenoviralPromoterU6Available sinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
-
pLentiV2-Opti-sgABCB7.1-puro
Plasmid#257583PurposesgRNA targeting ABCB7DepositorInsertABCB7 (ABCB7 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6 (sgRNA); EFS (Cas9 + puroR)Available sinceJune 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
B52 + PIK3R1 sgSTOP
Plasmid#100714PurposeB52 plasmid expressing PI3KR1 sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgSTOP targeting PIK3R1 (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable sinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
MYC sgRNA5
Plasmid#100557PurposeExpresses MYC sgRNA5. Target sequence GAGAGGCAGAGGGAGCGAGCDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMYC sgRNA5
PromoterU6Available sinceSept. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
TRCN0000279953
Plasmid#78154PurposeshCDK4 targeting CDSDepositorAvailable sinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Rosa26_gRNA
Plasmid#196138PurposegRNA targeting the Rosa26 locus in a thid generation Cas9 backbone with TagBFP2DepositorInsertRosa26 gRNA
UseCRISPR and LentiviralExpressionMammalianAvailable sinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCK671.306
Plasmid#192641PurposeExpresses dxCas9-NG and MCP-SoxS(R93A/S101A) and scRNA J306 on p15A-CmRDepositorInsertJ306 scRNA
UseCRISPR and Synthetic BiologyPromoterBBa_J23119Available sinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
TMPRSS2 g3
Plasmid#153017PurposeA guide RNA targeting TMPRSS2 in a lentiviral plasmid co-expressing mCherryDepositorInsertTMPRSS2 gRNA
UseCRISPR and LentiviralTagsmCherryAvailable sinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-rssA
Plasmid#89957PurposeContains arabinose-induced lambda Red and a tet-inducible gRNA targeting rssA.DepositorInsertrssA gRNA
ExpressionBacterialPromoterpTetAvailable sinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-malG
Plasmid#89951PurposeContains arabinose-induced lambda Red and a tet-inducible gRNA targeting malG.DepositorInsertmalG gRNA
ExpressionBacterialPromoterpTetAvailable sinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pADH100-2
Plasmid#90981PurposeNAT-marked C. albicans ADE2-specific gRNA expression construct; part 2 of 2 of C.alb HIS1-FLP CRISPR system. Use with pADH99 CAS9 expression construct.DepositorInsertNAT 2 of 2, pSNR52, ADE2 gRNA, gRNA conserved, FRT, DS_HIS1
UseCRISPRAvailable sinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTX198
Plasmid#89262PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsPDS gene, OsPDS-gRNA01DepositorInsertOsPDS-gRNA01
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable sinceMay 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_pos7_AmpR
Plasmid#119150PurposeEncodes sgRNA targeting position 7 in pColE1_70a_deGFP_KanRDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting position 7 in pColE1_70a_deGFP_KanR
UseCrisprAvailable sinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only