We narrowed to 24,332 results for: grna
-
Plasmid#88855PurposeCRISPR KO of Trp73DepositorInsertTrp73
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pH-PABE-7-sgRNA
Plasmid#115621PurposeTargeted A to G in riceDepositorInsertwtTadA-TadA7.10-nCas9-3*NLS
UseCRISPRExpressionPlantAvailable SinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
U6-sgRNAs-Crym
Plasmid#200067PurposeFor the knock down of Crym with an astrocyte specific mCherry expressionDepositorInsertU6-3xsgRNA-Crym
UseAAV, CRISPR, and Mouse TargetingTagsGfaABC1D-mCherryPromoterU6, GfaABC1DAvailable SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
4 gRNA concatemer
Plasmid#84881PurposeEmpty concatmer vector in which 4 gRNAs can be insertedDepositorTypeEmpty backboneUseRetroviralExpressionMammalianAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
AM77_pU6.Sa-gRNA.CLYBL
Plasmid#199237PurposeExpression construct encoding a S. aureus guide RNA targeting the human CLYBL safe harbor locusDepositorInsertS. aureus gRNA spacer
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNAAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPEPX-P3-sgRNAluc
Plasmid#85590PurposeIntegrate plasmid of Streptococcus pneumoniae, which can integrate sgRNA targeting luc gene, which encode luciferase, into the locus between amiF and treR. This vector can be used as the template forDepositorInsertsgRNA targeting firefly luciferase encoding gene
UseCRISPRExpressionBacterialPromoterP3Available SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pgRNA-R-gfp
Plasmid#220927PurposeExpresses gfp using J23119 promoter and pgRNA_AT backboneDepositorInsertsuperfolder GFP
TagsFLAGExpressionBacterialPromoterJ23119Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBSV2_Psyn-sgRNA500
Plasmid#149613PurposegRNA expression in B. burgdorferi, parental vectorDepositorTypeEmpty backboneUseCRISPRExpressionBacterialPromoterPsynAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S_P0526-sgRNAmreB
Plasmid#149654Purposeall-in-one CRISPRi vector for targeting B. burgdorferi mreBDepositorInsertdCas9, lacI, sgRNAmreB
UseCRISPRExpressionBacterialPromoterPflaB, PpQE30, P0526Available SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
2 gRNA concatmer
Plasmid#84879PurposeEmpty concatmer vector in which 2 gRNAs can be insertedDepositorTypeEmpty backboneUseRetroviralExpressionMammalianAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiGuidPuro-hTP63_sgRNA-1
Plasmid#88854PurposeCRISPR KO of Trp63DepositorInsertTrp63
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
Chr8q_Centromere-Targeting_gRNA
Plasmid#195128PurposegRNA targeting centromere-proximal location on Chromosome 8q in a third generation Cas9 backbone with GFPDepositorInsertChr8q gRNA
ExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-TKT_sgRNA2
Plasmid#201625PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertTKT (TKT Human)
UseCRISPR and LentiviralAvailable SinceJuly 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-TKT_sgRNA1
Plasmid#201624PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertTKT (TKT Human)
UseCRISPR and LentiviralAvailable SinceJuly 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
TOP2A sgRNA1
Plasmid#138190Purpose3rd generation lentiviral gRNA plasmid targeting human TOP2ADepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
TOP2A sgRNA2
Plasmid#138191Purpose3rd generation lentiviral gRNA plasmid targeting human TOP2ADepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJ23119-sgRNA
Plasmid#113654PurposesgRNA targeting unit plasmid. The sgRNA targeting unit plasmids contain connector ConLS, ConR1, and one sgRNA transcriptional unit.DepositorInsertpromoter J23119 and sgRNA
UseCRISPRExpressionBacterialPromoterJ23119Available SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
KAT2A sgRNA2
Plasmid#138186Purpose3rd generation lentiviral gRNA plasmid targeting human KAT2ADepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only