We narrowed to 10,063 results for: CAG
-
Plasmid#179414PurposeCell line generation via recombination-mediated cassette exchange (RMCE) and stable expression of TAF3.2xPHD-13XL-BASUDepositorInsertTAF3.2xPHD-13XL-BASU
ExpressionMammalianPromoterCAGGSAvailable sinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgKdm6a#1/Cre
Plasmid#173637PurposeExpresses a Kdm6a-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Kdm6a (Kdm6a Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable sinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-hPPM1B
Plasmid#185383PurposeFor mammalian expression of shRNA: GAGCAGAAGAGGATGAATTTA that targets human PPM1BDepositorAvailable sinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
MBP-TSF-TEVcs-ULK1K46I
Plasmid#171417PurposeFor the purifcation of human ULK1 kinase dead complexDepositorAvailable sinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTX1-SMN1-exon7-ESE1
Plasmid#126041PurposeIn-vitro-transcription of SMN1-exon7-ESE1 RNA in NMR tube for "Systems NMR" analysisDepositorInsertSMN1 exon7 ESE1
Available sinceMay 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgC1orf27-2
Plasmid#86131PurposeLentiviral vector expressing Cas9 and an sgRNA targeting C1orf27DepositorInsertsgRNA 2 targeting C1orf27 (C1orf27 )
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-sgRNA_Drosha_1
Plasmid#79860PurposeCRISPR/Cas9 DROSHADepositorInsertsgRNA Drosha
UseCRISPR and Mouse TargetingExpressionBacterial and MammalianAvailable sinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLCKO_PSMB2_sgRNA_5
Plasmid#74185Purposelentiviral vector expressing sgRNA targeting PSMB2DepositorInsertPSMB2 sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6 PromoterAvailable sinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX330-AAVS1
Plasmid#247356PurposeExpresses SpCas9 and a sgRNA targeting the human AAVS1 loci for knock-in.DepositorInsertAAVS1 (AAVS1 Human)
UseCRISPRAvailable sinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-USP7-sh1
Plasmid#235527PurposeshRNA against human USP7DepositorInsertUSP7 (USP7 Human)
UseLentiviralAvailable sinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgDHFR
Plasmid#233898Purposelentiviral vector expressing Cas9 and an sgRNA targeting DHFRDepositorAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-NLS-FRB-VP16
Plasmid#210515Purposeexpresses NLS-FRB-VP16 component in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertNLS-FRB-VP16
ExpressionMammalianPromoterCMVAvailable sinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
E42_gRunx1_gRNA3_dTet_NGFR
Plasmid#189803PurposeRetroviral delivery of guide RNA against mouse Runx1DepositorInsertgRunx1_gRNA3 (Runx1 Mouse)
UseRetroviralAvailable sinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-V2_mMSH2
Plasmid#186156PurposesgRNA targeting murine Msh2 geneDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMsh2_gRNA (Msh2 Mouse)
UseCRISPRExpressionMammalianPromoterU6Available sinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgBrca2#1/Cre
Plasmid#173627PurposeExpresses a Brca2-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Brca2 (Brca2 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable sinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgNeo1-mU6-sgNT-hU6-sgSnrk
Plasmid#177236PurposeExpresses neomycin (bU6), non-targeting (mU6) and Snrk (hU6) gRNAs and Cre-recombinaseDepositorInsertsgNeo1/sgNT1/sgSnrk
UseLentiviralPromoterbU6/mU6/hU6Available sinceJan. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRSITEP-puro-shWRN2-C911
Plasmid#125786Purposea seed-matched control for pRSITEP-puro-shWRN2DepositorInsertshWRN2 (WRN Human)
UseRNAiAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pISH-Tshz2
Plasmid#74361PurposeUse to synthesize riboprobes for in situ hybridization (ISH) probe for Tshz2. Not for gene expression.DepositorInsertteashirt zinc finger family member 2 (Tshz2 Mouse)
Available sinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCAH-MIBP16
Plasmid#51870PurposeExpresses C-terminal HA-tagged full length rat MIBP1 (cloned into pCAGGS)DepositorAvailable sinceMarch 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMZ-181
Plasmid#195429PurposeTransient, constitutive expression of synZiFTR: ZF6-p65DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertpUb - 3XFLAG - NLS - ZF6-4 (ZF6) - p65 - RbGpA
ExpressionMammalianAvailable sinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only