Skip to main content

167,318 results

Showing: 6461 - 6480 of 167318 results
  1. gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)

    Plasmid
    #217342
    Purpose
    crRNA array targeting CD81, B2M, KIT, CD55
    Depositor
    Inserts
    crCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
    crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
    crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
    crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
    crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
    crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
    Use
    CRISPR and Lentiviral
    Promoter
    hU6
    Available Since
    April 9, 2024
    Availability
    Academic Institutions and Nonprofits only
  2. pAR18_StrepI_mFASm_H8_pET22b

    Plasmid
    #122847
    Purpose
    Expresses murine type I fatty acid synthase (FASN) in Escherichia coli. N-terminal Twin-Strep tag; C-terminal H8-tag; in pET22b vector.
    Depositor
    Insert
    mouse FASN/ mouse fatty acid synthase (Fasn Mouse)
    Tags
    His8 tag and Twin-Strep tag
    Expression
    Bacterial
    Mutation
    wildtype
    Promoter
    T7 promoter
    Available Since
    March 19, 2019
    Availability
    Academic Institutions and Nonprofits only
  3. Antibody
    #194541-rAb
    Purpose
    Anti-HA recombinant mouse monoclonal antibody
    Depositor
    Recommended Applications
    Immunocytochemistry and Western Blot
    Source Species
    Mouse
    Isotype
    IgG2a
    Trial Size
    Available to purchase
    Available Since
    Feb. 9, 2023
    Availability
    Industry, Academic Institutions, and Nonprofits
    Western Blot image by Addgene
Showing: 6461 - 6480 of 167318 results