We narrowed to 875 results for: Anti-CRISPR
-
Plasmid#249560PurposedCas9_Suntag_PRDM9 targeting FWA promoterDepositorAvailable SinceFeb. 11, 2026AvailabilityAcademic Institutions and Nonprofits only
-
pM-Cas9
Plasmid#196325Purpose35S promoter-driven expression of the positive-sense TSWV M RNA segment encoding SpCas9 in place of viral GPDepositorInsertFull length TSWV M antigenome encoding SpCas9 in place of viral GP
UseCRISPRTags3×flagExpressionPlantMutationSee depositor comments belowPromoterduplicated cauliflower mosaic virus 35S promoterAvailable SinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pM-ABE
Plasmid#196292Purpose35S promoter-driven expression of the positive-sense TSWV M RNA segment encoding ABE in place of viral GPDepositorInsertFull length TSWV M antigenome encoding ABE in place of viral GP
UseCRISPRTags3×flagExpressionPlantMutationSee depositor comments belowPromoterduplicated cauliflower mosaic virus 35S promoterAvailable SinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
ScFv-2ERT2-VPH
Plasmid#120556PurposeEncode an antibody that binds to the GCN4 peptide from the SunTag system, and is fused to 2 tandem ERT2, VP64, P65 and HSF1DepositorInsertscFvGCN4, GB1, ERT2, VP64, P65 and HSF1
UseLentiviralExpressionMammalianPromoterhPGKAvailable SinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
ScFv-2ERT2-V
Plasmid#120553Purpose3rd gen transfer vector. Encode an antibody that binds to the GCN4 peptide from the SunTag system, and is fused to sfGFP, 2 tandem ERT2 and VP64.DepositorInsertscFvGCN4, sfGFP, GB1, ERT2, VP64
UseLentiviralExpressionMammalianPromoterhPGKAvailable SinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNA0304
Plasmid#165612PurposeVector for expression of sgRNAs in yeast: SNR52p-NotI-sgRNA-SUP4t (NotI site in place of the spacer)DepositorInsertSNR52p-NotI-sgRNA-SUP4t (S. cerevisiae SNR52 promoter driving the sgRNA for SpCas9, with a NotI site in place of the spacer)
UseCRISPRExpressionYeastMutationNotI site replaced the CAN1 spacer in parent vect…PromoterSNR52Available SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGG426_UV5
Plasmid#165608PurposeVector for expression of the SpCas9 VRKG variant with sgRNA in E. coli: lacUV5-VRKG(SpCas9, D1135V/S1136R/D1332K/R1333G) and UV5-sgRNA (hEGFP spacer)DepositorInsertlacUV5 driving Streptococcus pyogenes Cas9 VRKG(D1135V/S1136R/D1332K/R1333G) and hEGFP-sgRNA
UseCRISPR and Synthetic BiologyExpressionBacterialMutationD1135V, S1136R, D1332K and R1333G mutations in Sp…PromoterlacUV5 driving Cas9 VRKG and UV5 driving sgRNAAvailable SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
Cas9_nonPuro_OSS
Plasmid#186652PurposeCas9 plasmid to express the Cas9 in OSS cellsDepositorInsertOSS Cas9 Expression Plasmid
ExpressionInsectAvailable SinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ8702 pHR-TRE3G-AcrVA1-EF1a-sfGFP-T2A-rtta-WPRE
Plasmid#140229PurposeDox-inducible expression of anti-Cpf1 AcrVA1. Constitutive EF1a driven rtTA and GFPDepositorInsertAntiCRISPR protein AcrVA1
UseLentiviralExpressionMammalianPromoterTRE3GAvailable SinceMay 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
Suntag_dPRDM9_FWA_g4
Plasmid#249562PurposedCas9_dPRDM9 catalytically dead versionDepositorInsertPRDM9 (Prdm9 Mouse)
UseSynthetic BiologyTagsHA and sfGFPExpressionPlantMutationG282A (Numbering from the the full length sequenc…PromoterUBQ10Available SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSLQ5079_pHR_PGK_sfGFP_CoV-F1
Plasmid#155303PurposeSARS-CoV-2 fluorescent reporter 1DepositorInsertSuperfolder GFP fused with SARS-CoV-F1 (ORF1ab Synthetic)
UseLentiviralExpressionMammalianPromoterPGKAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
CAG-LoxpStopLoxp-NLS-dCas9-HA-NLS-NLS-10xGCN4-NLS-P2A-scFv-NLS-P65-HSF1-Flag-T2A-EGFP-WPRE-PolyA
Plasmid#107307PurposeEncoding an SPH activation systemDepositorInsertCAG-LSL-dCas9-10xGCN4-P2A-scFv-P65-HSF1-T2A-EGFP-WPRE-PolyA
ExpressionMammalianAvailable SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro CAG eGFP NLS
Plasmid#170830PurposeDonor plasmid for knocking eGFP NLS into AAVS1 safe harbor locusDepositorInserteGFP
UseCRISPR, Synthetic Biology, and TALENTagsNLSExpressionMammalianPromoterCAGAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19_Ntag_BbsI-Mammalian
Plasmid#186674PurposeN-terminal tag cassette with BbsI restriction sites for CRISPR donor plasmid.DepositorInsertMammalian N-terminal Tag
Tags3xFlag-3xHAExpressionMammalianAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGW011b Dual AAV vector pAAV-EFS-dCAS9-spA
Plasmid#192160PurposeDual AAV vector AAV-dCas9DepositorInsertDead Cas9
UseAAVMutationNAAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMK-AttL1-NotI/BamHI-U6-BsaI-tracrRNAopt-BamHI-U6-SapI-tracrRNAopt-NotI/XbaI-7sk-BsmBI-tracrRNA-XbaI-AttL2
Plasmid#190898PurposeEntry vector for multiple sgRNA cloningDepositorTypeEmpty backboneUseCRISPRExpressionBacterial and MammalianPromoterU6 and 7skAvailable SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGG431
Plasmid#165615PurposeVector for expression of SpCas9 in yeast after assembly with PID fragments: TEF1p-SpCas9::KanR-1xNLS-CYC1t (KanR cassette in place of the PID)DepositorInsertTEF1p-SpCas9::KanR(in place of PID)-1xNLS-CYC1t (S. cerevisiae TEF promoter driving SpCas9 with KanR cassette replacing PID)
UseCRISPRTagsSV40 NLSExpressionYeastMutationCorrected homology relative to wild type SpCas9 (…PromoterTEF1Available SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRepair-SGFP2-CTNNB1
Plasmid#153430PurposeHomology Directed Repair construct for N-terminal tagging of hsCTNNB1 with SGFP2DepositorInsertCTNNB1 homology arms and mTurquoise2 coding sequence (CTNNB1 Human)
UseCRISPR; Hdr donor templateTagsSGFP2Available SinceSept. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX459-CTNNB1-ATG
Plasmid#153429PurposeExpresses a gRNA that overlaps the startcodon of human CTNNB1DepositorAvailable SinceSept. 1, 2020AvailabilityAcademic Institutions and Nonprofits only