We narrowed to 1,137 results for: rbis
-
Plasmid#172606PurposeExpresses gRNA #3 against AMBRA1 and Cas9 from S. pyogenes with 2A-PuroDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only
-
REV human OCT4 TALEN
Plasmid#52413PurposeTALEN expressing vector used to allow Knock-in of OCT4-GFP-2A-PURO knockin donor plasmid (generated by Jaenisch lab- Addgene Vector # 31939)DepositorInsertHD HD HD HD HD NI NG NG HD HD NG NI NN NI NI NN NN
UseTALENPromoterCAGGSAvailable SinceJune 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
FUW-Mbd3
Plasmid#52356PurposeLentiviral expression vector for constitutive expression of Mbd3DepositorAvailable SinceSept. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-HSD17B11
Plasmid#161923PurposeTo generate HSD17B11 KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against HSD17B11 exon 1.DepositorInsertsgRNA targeting HSD17B11 exon 1
UseCRISPRPromoterU6Available SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-2xFLAG-2xSTREP-CDK4
Plasmid#172615PurposeExpresses 2xFLAG-2xSTREP-tagged CDK4 in mammalian cellsDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-2xFLAG-2xSTREP-CCND3
Plasmid#172623PurposeExpresses 2xFLAG-2xSTREP-tagged cyclin D3 in mammalian cellsDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
FUW-CAGGS-ERAS
Plasmid#52416PurposeLentiviral vector encoding constitutive expression of human ERAS cDNADepositorAvailable SinceMay 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CCND1(T286A)
Plasmid#172631PurposeExpresses untagged cyclin D1(T286A) in mammalian cellsDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
TRE-dCas9(sa)-VP64-AAV
Plasmid#213035PurposedCas9-VP64 expressed under control of TREDepositorInsertdCas9
UseAAV and CRISPRTagsNLS and NLS-VP64PromoterTRE, miniCMVAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pB-TR-TTHA
Plasmid#232479PurposeTetracycline inducible PiggyBac vector expressing bacterial TTHA1718 (TTHA) gene gene including flag-tag (DYKDDDDK) on the 3' endDepositorInsertThermus thermophilus HB8
UseTransposon systemTagsDYKDDDDK (FLAG-tag)ExpressionMammalianPromoterCMV-TetOAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pnEA-vH_His-TEV-DSep1-msfGFP
Plasmid#174494Purposebacterial expression of Drosophila Sep1 fused to monomeric superfolder GFPDepositorAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
px458-AMBRA1 #3
Plasmid#172607PurposeExpresses gRNA #3 against AMBRA1 and Cas9 from S. pyogenes with 2A-EGFPDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
BPK1520 sgCHMP1A
Plasmid#169321PurposeExpresses CHMP1a targeting sgRNA in non-lentiviral BPK1520 plasmidDepositorInsertsgCHMP1A
UseCRISPRExpressionMammalianAvailable SinceMay 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
BPK1520 sgCHMP4B
Plasmid#169322PurposeExpresses CHMP4B targeting sgRNA in non-lentiviral BPK1520 plasmidDepositorInsertsgCHMP4B
UseCRISPRExpressionMammalianAvailable SinceMay 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
OCT4-GFP-2A-PURO transgenic reporter
Plasmid#52379PurposeBAC recombineering generated construct, used as a reporter for OCT4 expressionDepositorInsertsGFP-2A-puro
OCT4
ExpressionMammalianPromoterOCT4Available SinceOct. 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT3TS-RfxCas13d-HA
Plasmid#141320PurposePlasmid to carry out IVT of RfxCas13d (human codon-optimized)DepositorInsertRfx-Cas13d
UseCRISPRTagsHAAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-28b-RfxCas13d-His
Plasmid#141322PurposePlasmid for bacterial expression and purification of RfxCas13d proteinDepositorInsertRfx-Cas13d
UseCRISPRTags6xHisExpressionBacterialPromoterT7Available SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pICE-EGFP-FLAG-PLIN3
Plasmid#161918PurposeExpresses human PLIN3 with a N-terminal GFP-FLAG tag. Confers Puromycin resistance. Inducible in T-REx cells.DepositorAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only