We narrowed to 10,326 results for: Ada;
-
Plasmid#117745PurposeOpen reading frame vector encoding DEDDDepositorAvailable SinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pKK-TEV-mCardinal
Plasmid#105798PurposeExpression of your protein of interest in fusion with red fluorescent protein at the C-terminus (cleavable by TEV), (PMID: 24633408). mCardinal is suitable for deep-tissue imaging.DepositorTypeEmpty backboneUseFlp-in competentTagsTEV-mCardinalExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKK-TEV-mCerulean
Plasmid#105790PurposeExpression of your protein of interest in fusion with cyan fluorescent protein at the C-terminus (cleavable by TEV). Useful for FRET experiments (PMID: 14990965, 17040988, 22264545).DepositorTypeEmpty backboneUseFlp-in competentTagsTEV-mCeruleanExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKK-mCardinal-TEV
Plasmid#105781PurposeExpression of your protein of interest in fusion with red fluorescent protein at the N-terminus (cleavable by TEV), (PMID: 24633408). mCardinal is suitable for deep-tissue imaging.DepositorTypeEmpty backboneUseFlp-in competentTagsmCardinal-TEVExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKK-mCerulean-TEV
Plasmid#105773PurposeExpression of your protein of interest in fusion with cyan fluorescent protein at the N-terminus (cleavable by TEV). Useful for FRET experiments (PMID: 14990965, 17040988, 22264545).DepositorTypeEmpty backboneUseFlp-in competentTagsmCerulean-TEVExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
GST-beta2(616-951)∆CBM
Plasmid#100745PurposeBacterial expression of GST-tagged beta2 subunit of AP2 complex (hinge and ear) long splice form, mutantDepositorInsertbeta2 adaptin (AP2B1 Human)
TagsGSTExpressionBacterialMutationLong isoform with deletion of clathrin binding mo…Available SinceSept. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLuc-OptoJNKi
Plasmid#89744PurposeExpression of light-regulated JNK inhibitor, firefly luciferase-fused, wild-type photosensor, inhibitor JIP11DepositorInsertOptoJNKi
UseLuciferaseTagsFirefly luciferaseExpressionMammalianPromoterCMVAvailable SinceAug. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3/ TO myc-cCE-bio (cCE-bio)
Plasmid#82473PurposeExpresses cytoplasmic restricted form of N-terminal myc tagged and C-terminal biotin tagged mRNA capping enzyme, inactive formDepositorInsertMyc-NES-mCE (Wt, NLS deletion)-TEV-Bio (Rngtt Mouse, Synthetic)
TagsTEV-Biotin and mycExpressionMammalianPromoterCMVAvailable SinceSept. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBullet-cyt-n
Plasmid#53065Purposedestination vector with cytosol marker (ECFP) for tagged fluorescent protein (N-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyTagsECFP and EYFPAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBullet-er-n
Plasmid#53067Purposedestination vector with WAK2 (29 aa)-ECFP- ER marker (HDEL) for tagged fluorescent protein (N-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyTagsECFP and EYFPAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBullet-tgn-n
Plasmid#53071Purposedestination vector with ECFP-trans golgi network marker (VTI12) for tagged fluorescent protein (N-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PEmax
Plasmid#174820PurposeMammalian expression of SpCas9 PEmax prime editorDepositorInsertPEmax
TagsSV40 bpNLS and c-Myc NLSExpressionMammalianMutationDetailed in manuscriptPromoterCMVAvailable SinceOct. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCF159_BRL
Plasmid#225962PurposeCMV-Intron-BRL (env protein). Expresses BRL (BaEVRLess) env for VLP production.DepositorInsertCMV-Intron-BRL (env protein)
ExpressionMammalianAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7-PEmax for IVT
Plasmid#178113PurposeTemplate for in vitro transcription of PEmaxDepositorInsertPEmax
UseTemplate for in vitro transcriptionTagsSV40 bpNLS and c-Myc NLSMutationDetailed in manuscriptPromoterT7 (inactivated)Available SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28-MBP-super TEV protease
Plasmid#171782PurposeExpresses Maltose-binding protein-super TEV protease in bacterial cytoplasm. This protease version performs well in the absence of added reducing agent.DepositorInsertMBP-sTEV
TagsArg6 tag and Internal His6 tagExpressionBacterialMutationNo internal TEV cleavage site between the MBP and…PromoterT7Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRIS-PITChv2-Puro-dTAG (BRD4)
Plasmid#91793PurposePITCh dTAG donor vector for Puro-P2A-2xHA-FKBP_F36V knock-in into the N-terminus of the human BRD4 locus.DepositorInsertPuro-P2A-2xHA-FKBP_F36V
UseCRISPRExpressionMammalianMutationPhenylalanine 36 to valine in FKBP12PromoterPromotorlessAvailable SinceMarch 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV-MRLC1-mRuby2-IRES-PuroR
Plasmid#103031PurposeLentiviral expression of mRuby2-tagged MRLC with puromycin selectionDepositorAvailable SinceMay 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hsyn_NES-his-CaMPARI2-WPRE-SV40
Plasmid#101060PurposeAAV vector expressing CaMPARI2 (Kd = 200nM), a photoconvertible fluorescent protein-based calcium integrator, in neuronsDepositorHas ServiceAAV1InsertCaMPARI2
UseAAVTagsFLAG-HA-myc and NES_hisPromoterhsyn (synapsin-1)Available SinceOct. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCRIS-PITChv2-dTAG-Puro (BRD4)
Plasmid#91796PurposePITCh dTAG donor vector for FKBP_F36V-2xHA-P2A-Puro knock-in into the C-terminus of the human BRD4 locus.DepositorInsertFKBP_F36V-2xHA-P2A-Puro
UseCRISPRExpressionMammalianMutationPhenylalanine 36 to valine in FKBP12PromoterPromotorlessAvailable SinceMarch 26, 2018AvailabilityAcademic Institutions and Nonprofits only