We narrowed to 19,702 results for: CAL
-
Plasmid#42304DepositorInsertNpuDnaE C-intein
TagsGB1-H6ExpressionBacterialPromoteraraBADAvailable SinceSept. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMM2-rPMCA3b
Plasmid#47763Purposemammalian expression of rat PMCA3bDepositorAvailable SinceSept. 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
FUW-M2-PAK2 S20A
Plasmid#31664DepositorInsertp21-activated protein kinase 2 S20A (PAK2 Human)
UseLentiviralTagsM2ExpressionMammalianMutationChanged Serine 20 to AlanineAvailable SinceApril 12, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCMV-bpNLS-eeBxb1 (CJT555)
Plasmid#248209PurposeeeBxb1 recombinase with N-terminal bpNLS, expressed from a CMV promoter.DepositorInsertbpNLS-eeBxb1
UseCRISPR; In vitro transcriptionTagsBPNLSExpressionMammalianMutationeeBxb1(V74A, E229K, V375I)PromoterCMV and T7Available SinceApril 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDisplay-GRAB-HaloDA1.0-IRES-EGFP-CAAX
Plasmid#234410PurposeExpresses the chemigenetic dopamine (DA) sensor GRAB_HaloDA1.0 and a membrane-localized EGFP in mammalian cellsDepositorInsertGPCR activation based chemigenetic dopamine (DA) sensor GRAB_HaloDA1.0
ExpressionMammalianPromoterCMVAvailable SinceJune 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
FLAG-GRP78-Wild-Type
Plasmid#235169PurposeExpresses Wild-Type GRP78 in mammalian cellsDepositorAvailable SinceMay 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-puro_FlnaABD-TS-16flag
Plasmid#234868PurposeExpresses control FlnA-based tension sensor that lacks dimerization domain and therefore does not report tension.DepositorInsertFlnA Actin binding domain, Ig 15, GFP-F40-RFP, FlnaA Ig 16
UseLentiviralTagsGFP, RFP, FLAGExpressionMammalianPromoterCMVAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-puro_FlnaABD-15-TS-16-24flag
Plasmid#234869PurposeExpresses the FlnA actin binding domain and Ig15 , a FRET construct containing GFP-F40-RFP, the FlnA Ig 16 and Ig 24 domains.DepositorInsertFlnA Actin binding domain, Ig 15, GFP-F40-RFP, FlnaA Ig 16, FlnA Ig 24
UseLentiviralTagsGFP, RFP, FLAGExpressionMammalianPromoterCMVAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFP5380 LAMP1-SBP- mCherry-FIREtag
Plasmid#216725PurposeExpresses LAMP1-mCherry-FIREtag in mamallian cellsDepositorInsertLAMP-1 (LAMP1 Human)
TagsFIREtag, Streptavidin Binding Protein (SBP), and …ExpressionMammalianPromoterCMVAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-GFAP-iGABASnFR2-WPRE
Plasmid#218871PurposeAAV-mediated expression of improved GABA sensor (positive change in fluorescence)DepositorHas ServiceAAV1 and AAV5InsertiGABASnFR2
UseAAVExpressionMammalianMutationS99A F102Y F104Y L178SPromoterGFAPAvailable SinceMay 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
MSCV-ASNS-OE-IRES-Thy1.1
Plasmid#192947PurposeAsparagine synthetase overexpression in murine cellsDepositorAvailable SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV2/9-CW3SL-mCherry-DrTrkB
Plasmid#184002PurposeAAV production for expression of optically controlled eDrTrkB with N-terminal fusion of mCherryDepositorAvailable SinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-sgMaob-HepmCherry
Plasmid#192829PurposeExpresses sgRNA targeting Maob and mCherry from hepatocyte-specific promoterDepositorInsertmCherry
UseCRISPR and LentiviralExpressionMammalianPromoterU6 for sgRNA and hepatocyte-specific promoter (HS…Available SinceNov. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT005
Plasmid#182715PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
SSpB-HaloTag-p63DH
Plasmid#176116PurposeHeterodimerization with iLID, RhoA activationDepositorInsertRHOGEF p63 (ARHGEF25 Human)
ExpressionMammalianAvailable SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEBTet-SNAP-Cep78
Plasmid#136827PurposeMammalian expression of the centrosomal protein Cep78 N-terminally fused to SNAP-tagDepositorInsertSNAP-Cep78 (CEP78 Human, Synthetic)
TagsFLAG-tag / His-tagExpressionMammalianPromoterCMV-TetO2Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
mcherry-Myo 9b R1695M
Plasmid#134958PurposeExpression of rat Myo 9b (Myr 5) in mammalian cells.GAP minus mutant.DepositorInsertMyo 9b (rat) with 3' UTR. GAP minus mutant R1695M (Myo9b Rat)
TagsmcherryExpressionMammalianPromoterCMV IEAvailable SinceJan. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28a-C9ORF80
Plasmid#128418PurposeExpress C9ORF80 in E. coli with a His tag (C-terminal)DepositorAvailable SinceAug. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
mApple-proα1(I)
Plasmid#119844PurposeExpresses mouse Type I procollagen α1 chain (Col1a1) with mApple replacing exon 2-3 retaining N-propeptide minor triple helix and N-terminal cleavage siteDepositorInsertType I procollagen α1 chain (Col1a1 Mouse)
TagsmAppleExpressionMammalianMutationCol1a1 exons 2-3 replaced by fluorescent tagPromoterCMVAvailable SinceJan. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
mApple-proα2(I)
Plasmid#119840PurposeExpresses mouse Type I procollagen α2 chain (Col1a2) with mApple between signal sequence and exon 6DepositorInsertType I procollagen α2 chain (Col1a2 Mouse)
TagsmAppleExpressionMammalianMutationCol1a2 exons 2-5 replaced by fluorescent tagPromoterCMVAvailable SinceJan. 28, 2019AvailabilityAcademic Institutions and Nonprofits only