We narrowed to 12,977 results for: NUC
-
Plasmid#45452DepositorAvailable SinceJune 20, 2013AvailabilityAcademic Institutions and Nonprofits only
-
MSP712
Plasmid#65768PurposeBacterial expression plasmid for Sp-dCas9 & sgRNA (need to clone in spacer into BsaI sites): T7-humanSpdCas9(D10A/H840A)-T7-BsaIcassette-Sp-sgRNADepositorInsertmammalian codon-optimized Streptococcus pyogenes dCas9 (D10A/H840A)-NLS-3XFlag, and SpCas9 gRNA
UseCRISPRTags3x FLAG and NLSExpressionBacterialMutationD10A and H840A mutations in Cas9PromoterT7 (x2)Available SinceJune 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBABEPuro-HA-GLI1
Plasmid#62967PurposeExpresses HA-tagged Gli1DepositorAvailable SinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET28a-PKM2-R399E
Plasmid#122691PurposeExpress His-tagged PKM2 (R399E) protein in bacteria.DepositorAvailable SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
LLP775_αGCN4-p65HSF1-CO
Plasmid#211768PurposeSunTag counterpart binding domain, aGCN4, fused to transcriptional activator p65HSF1, with GFP selectionDepositorInsertaGCN4-p65HSF1
Tags3xTy1ExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect p65HSF…PromoterpEF1a and pSV40Available SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMJ923
Plasmid#78313PurposeExpression of His6-MBP-tagged Cas9-NLS-mCherry protein in E. coliDepositorInsertSpCas9
TagsHA-2xNLS-mCherry-NLS and His6-MBP-TEVExpressionBacterialMutationhuman codon-optimized gene sequencePromoterT7Available SinceJune 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET28a-TEV-TBP6.9F34MF37MF77M
Plasmid#168268PurposeExpresses human TBP6.9 with the F34M/F37M/F77M triple mutantDepositorInsertTBP6.9
Tags6xHis tag N-terminus, TEV protease cleavage siteExpressionBacterialMutationchanged F34M, F37M and F77MPromoterT7 promotorAvailable SinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pIL6-Nluc-hbb
Plasmid#239843PurposeTemplate for in vitro transcription of secreted nanoluciferase, with interleukin 6 signal peptide, flanked by the human haemoglobin beta 5' and 3' UTRs.DepositorInsertSecreted nanoluciferase, with interleukin 6 signal peptide, flanked by human haemoglobin beta 5' and 3' UTRs
UseLuciferasePromoterT7 (included as part of insert)Available SinceJuly 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMX GFP Rac G12V
Plasmid#14567DepositorAvailable SinceApril 12, 2007AvailabilityAcademic Institutions and Nonprofits only -
pEJS887_pTetR-P2A-BFPnls/sgAlpha
Plasmid#108651PurposeAlpha satellite repeats targeting Spy sgRNA under U6 promoterDepositorInsertsAlpha satellite repeats targeting sgRNA
TetR-P2A-BFP
UseCRISPR and LentiviralTagsNoExpressionMammalianPromoterU6 and hPGKAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330 Human 3' HP1a gRNA
Plasmid#127907PurposeWT Cas9 Vector targeting the 3' end of the human HP1a geneDepositorInsertgRNA for Human 3' HP1a
UseCRISPRAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28a-PKM2-H391Y
Plasmid#122692PurposeExpress His-tagged PKM2 (H391Y) protein in bacteria.DepositorAvailable SinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA-CUL1 Y42A/M43A
Plasmid#19940DepositorInsertcullin 1 Y42A/M43A (CUL1 Human)
TagsHA2ExpressionMammalianMutationCUL1 with a SKP1 binding mutantAvailable SinceMay 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
pEN_TT 3xFLAG-CSE1L
Plasmid#192295PurposeGateway entry vector for an inducible 3xFLAG-CSE1LDepositorAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pmirGLO:Δluc::gfp ΔAmpR::KanR
Plasmid#176640PurposeMPRAu backbone vectorDepositorInsertemGFP
ExpressionMammalianPromoterHuman PGK-1Available SinceFeb. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHS0923 pET45b(+) His14-MBP-TEV-AmaTnpB
Plasmid#176587PurposeBacterial expression of His14-MBP-TEV-AmaTnpBDepositorInsertsMBP tag
TnpB
TagsHis14 tagExpressionBacterialAvailable SinceOct. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA6A-EGFR ICD (645-1186)
Plasmid#42667DepositorAvailable SinceJune 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pRosa26-GT
Plasmid#40025DepositorInsertsGFP
beta-globin intron
Neo
tdT-3Myc
diphteria toxin A
Tags3 Myc tagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta globin promoter and CMV enhance…Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTPH413
Plasmid#185728PurposeBacterial PAM profiling of adenine base editor variantsDepositorInsertsecTadA(8e)-neNme2-C
Nme2Cas9 sgRNA
UseCRISPRExpressionBacterialMutationNme2Cas9 P6S/D16A/E33G/K104T/D152A/F260L/A263T/A3…Available SinceSept. 16, 2022AvailabilityAcademic Institutions and Nonprofits only