We narrowed to 16,086 results for: NOL
-
Plasmid#74285PurposeGene targeting vector for the mouse Rosa26 locus, including a CAG promoter, loxP flanked stop cassette and GFP, for cloning into AscIDepositorInsertRosa26 5-homology region
UseMouse TargetingAvailable SinceApril 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
v3em-Nterm-PE2max
Plasmid#198734PurposeAAV genome encoding N-terminal PE2maxDepositorInsertNterm PE2max-NpuN
UseAAVPromoterCbhAvailable SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1179 U6-reci Gag-Cas9 v2
Plasmid#201914PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and sgRNA (human U6 promoter. BsmBI cutsites for spacer insertion)DepositorInsertGag-Cas9 v2
ExpressionMammalianPromoterCAGAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
pR26 CAG AsiSI/MluI
Plasmid#74286PurposeGene targeting vector for the mouse Rosa26 locus, including a CAG promoter and loxP flanked stop cassette, for cloning into AsiSI or MluiDepositorInsertRosa26 5-homology region
Available SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-SpRY-ABE8e
Plasmid#185671PurposeExpresses SpRY-ABE8e in mammalian cellsDepositorInsertecTadA(8e)-nSpRY
UseCRISPRExpressionMammalianMutationSpRY D10AAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pR26 CAG/GFP Dest
Plasmid#74281PurposeGene targeting vector for the mouse Rosa26 locus, including a CAG promoter, loxP flanked stop cassette, GFP, for gateway cloningDepositorInsertRosa26 5-homology region
UseMouse TargetingAvailable SinceApril 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pR26 CAG/BFP Dest
Plasmid#74282PurposeGene targeting vector for the mouse Rosa26 locus, including a CAG promoter, loxP flanked stop cassette, BFP, for gateway cloningDepositorInsertRosa26 5-homology region
Available SinceMay 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRDA_834
Plasmid#216087PurposeCas9 [Sp] knockout targeting CD59, positive controlDepositorInsertCD59 guide
UseCRISPR and Lentiviral; Positive controlsAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCTCON2 Aga2P-HRP
Plasmid#73152PurposeFull-length horseradish peroxidase (HRP) fused to the C-terminus of the yeast mating protein Aga2P. Galactose-inducible expression.DepositorInsertAga2P-HRP
TagsHA tag and myc tagExpressionYeastPromoterGAL1Available SinceJune 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1362 scFv entry plasmid
Plasmid#201912PurposeEntry vector for cloning single chain variable fragments displayed on the human CD8a hinge and transmembrane domain (CAG promoter)DepositorInsertStuffer sequence (drop out for scFv cloning) + CD8 hinge and transmembrane domain
ExpressionMammalianPromoterCAGAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
p101_CRISPRai_PiggyBac
Plasmid#213777PurposeExpresses Tet-On inducible CRISPRai orthogonal system with VPR-dSaCas9, dSpCas9-KRAB-BFP, zeocin resistance gene, and Tet-On transactivator. PiggyBac vector.DepositorInsertsVPR-dSaCas9
dSpCas9-KRAB-BFP
zeocin
Tet-On transactivator
UseCRISPRPromoterEF1a (EF-1-alpha intron a) and Tet_On_TREAvailable SinceMay 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-ER alpha
Plasmid#28230PurposeMammalian expression of Estrogen Receptor alpha fused to EGFPDepositorAvailable SinceApril 7, 2011AvailabilityAcademic Institutions and Nonprofits only -
pDN0606 (pDEST-DHFR F[3] N-term,HygR)
Plasmid#210488PurposepDEST vector to tag gene of interest with DHFR F[3] on the N-terminus to perform DHFR-PCA in S. cerevisiae.DepositorTypeEmpty backboneUseSynthetic Biology; Destination vector for gateway…ExpressionYeastPromoterADH1Available SinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKB11 (pDEST-DHFR F[1,2] C-term, NatR)
Plasmid#210485PurposepDEST vector to tag gene of interest with DHFR F[1,2] on the C-terminus to perform DHFR-PCA in S. cerevisiae.DepositorTypeEmpty backboneUseSynthetic Biology; Destination vector for gateway…ExpressionYeastPromoterADH1Available SinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
EK0387 SFFV-mTagBFP2-SGc(Bdnf.s1)cSG-mCherry (FLP-IN)
Plasmid#191157PurposeExpression of a sensor for murine Bdnf 3' UTR in mammalian cells; mTagBFP2 marker, mCherry output; 90 bp longDepositorInsertmTagBFP2:Bdnf.s1:mCherry
ExpressionMammalianMutationWTPromoterSFFVAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
mEGFP-NbALFA
Plasmid#159986PurposeFor the expresson and purification of the EGFP-tagged anti-ALFA tag nanobody (NbALFA)DepositorInsertmEGFP-NbALFA
Tags8histidine-HRV3C protease cleavage siteExpressionBacterialMutation3GS linker between mEGFP and NbALFAAvailable SinceOct. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGWB511
Plasmid#74853PurposeGateway cloning compatible binary vector for C-terminal fusion with FLAG (CaMV35S promoter).DepositorTypeEmpty backboneExpressionPlantPromoterCaMV35SAvailable SinceSept. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
attB-puro-GA donor
Plasmid#182138PurposeattB-puro-GA DNA donor for twinPE and Bxb1 mediated gene-size insertionDepositorInsertattB-GA-EGFP-EF1α-PuroR-T2A-TagBFP
ExpressionMammalianAvailable SinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only