We narrowed to 30,763 results for: promoter
-
Plasmid#78512PurposeConstruct for expressing His10 - SNAPf in E. ColiDepositorInsertSNAPf
TagsHis10 followed by a prescission protease claevage…ExpressionBacterialAvailable SinceJune 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pF(UG) hSyn SYT7alpha-HaloTag
Plasmid#179715PurposeLentiviral expression of mouse Syt7 with C terminal HaloTagDepositorInsertSYT7 (Syt7 Mouse)
UseLentiviralAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXEE401BG
Plasmid#91717PurposeCRISPR/Cas9-mediated genome editing in Arabidopsis, Bar and glyphosate-resistanceDepositorTypeEmpty backboneExpressionPlantAvailable SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 HA-rnSOX9
Plasmid#62972PurposeExpresses HA-tagged rat SOX9DepositorAvailable SinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pscALPS gag-gfp/deltavpx
Plasmid#115807PurposeSFFV promoter expresses gag-gfp fusion with no ORF after CypA promoterDepositorInsertgag-gfp
UseLentiviralPromoterSFFVAvailable SinceMarch 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCR3-vsv-Sgo1 N61I
Plasmid#108496Purposeexpression of vsv-Sgo1 N61I (no PP2A binding)DepositorInsertShugoshin 1 (SGO1 Human)
TagsVSVExpressionMammalianMutationno PP2A binding N61IPromoterCMVAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-hBcan
Plasmid#18966DepositorInsertBrevican (BCAN Human)
ExpressionMammalianAvailable SinceDec. 12, 2008AvailabilityAcademic Institutions and Nonprofits only -
pTRE2-Bla(HA–RILP)
Plasmid#102425PurposeHA tag fused to the N-terminus of RILP for the expression in mammalian cells.DepositorInsertRab interacting lysosomal protein (RILP Human)
TagsHAExpressionMammalianPromoterTet-responsiveAvailable SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPANI2A2E2-Crimson
Plasmid#193758PurposeExpresses E2-Crimson under the control of PANI2 synthetic promoter, ColE1 origin of replication, Ampicillin selectionDepositorInsertE2-Crimson
UseSynthetic BiologyExpressionBacterialPromoterPANI2 synthetic promoter carrying binding sites f…Available SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pWPI-TFDP1
Plasmid#114299PurposeConstitutive expression of the TFDP1 proteinDepositorInsertTFDP1 (TFDP1 Human)
UseLentiviralAvailable SinceNov. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
htpG2-GFP
Plasmid#109388PurposeGFP cassette under the control of the htpG2 sigma32-responsive promoter. Used to test burden-responsive behaviour of the wt genomic promoter. The plasmid has got ColE1 origin of replication and AmpR.DepositorInsertphtpG2-GFP
ExpressionBacterialAvailable SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nDsRedFL-intron
Plasmid#177804PurposeAn intron is inserted into the DsRed gene with a nuclear transfer signal and a 3xFlag tag. The intron can be digested with EcoRV and any pre-miRNA can be inserted.DepositorInsertintron
ExpressionMammalianAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
3xFLAG-dCas9/pMXs-IG
Plasmid#51258PurposeExpresses 3xFLAG-dCas9 in mammalian cells for enChIP analysis to purify specific genomic regions of interest.DepositorInsert3xFLAG-dCas9
UseCRISPR and RetroviralTags3xFLAG tag and NLS (nuclear localization signal)ExpressionMammalianMutationhuman codon-optimized, D10A + H840APromoterLTRAvailable SinceAug. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMADM-beta
Plasmid#36891DepositorInsertsBeta-Geo
thymidine kinase
ExpressionMammalianPromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-kanMX6-PGAL1
Plasmid#41605DepositorInsertGAL1 promoter (GAL1 Budding Yeast)
UseYeast genomic targetingTagsA. gossypii translation elongation factor 1a gene…Available SinceDec. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
GG-EBNA-OCT4
Plasmid#69537PurposeEpisomal plasmid encoding 5 gRNAS targeting human OCT4 promoterDepositorInsert5 concatenated gRNA transcriptional cassettes targeting OCT4
UseCRISPRAvailable SinceDec. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pZmUbi-5'UTR
Plasmid#154057PurposeLevel 0 Golden Gate vector, containing the ZmUbi promoter and 5' UTR with Level 0.5-compatible overhangs (Wheat construct)DepositorInsertPromoter and 5' UTR Ubiquitin (Zea mays)
UseSynthetic BiologyExpressionBacterialPromoterN/AAvailable SinceSept. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-E1.1-RFP
Plasmid#22928DepositorInsertE1.1 binding site from Scardigli et al., 2003 with minimal CMV
UseAAVExpressionMammalianAvailable SinceMay 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
pHes1-GFP (CC#109)
Plasmid#15133DepositorAvailable SinceJune 8, 2007AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only