We narrowed to 7,733 results for: CCH
-
Plasmid#115205PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A/S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A/S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2
Plasmid#115199PurposeLentiviral transduction and expression of a CRISPR/Cas9-resistant PDHA2 into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2WT (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A
Plasmid#115203PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
NYESO beta/alpha into TRAC HDRT Source (pTR 169)
Plasmid#112021PurposeDNA sequence source for amplifying an HDR template to replace endogenous human TCR with 1G4 NYESO TCR at TCR-alphaDepositorInsertNYESO beta/alpha into TRAC HDRT
UseCRISPR and Synthetic BiologyAvailable SinceSept. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
NYESO alpha/beta into TRBC1 HDRT Source (pTR 262)
Plasmid#112022PurposeDNA sequence source for amplifying an HDR template to replace endogenous human TCR with 1G4 NYESO TCR at TCR-betaDepositorInsertNYESO alpha/beta into TRBC1 HDRDT
UseCRISPR and Synthetic BiologyAvailable SinceNov. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAMS823 His6-MBP-3C-ORF2p (238-1061, ORFeus-Hs) in pET41
Plasmid#213024PurposeExpresses human LINE-1 ORF2p Core (238-1061) in E. coli as an N-MBP fusionDepositorInsertLINE-1 ORF2p (238-1061)
TagsHis6-MBP-3CExpressionBacterialPromoterT7 / LacAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NYESO alpha into TRAC HDRT Source (pTR 223)
Plasmid#112023PurposeDNA sequence source for amplifying an HDR template to replace endogenous human TCR-alpha with 1G4 NYESO TCR-alphaDepositorInsertNYESO alpha into TRAC HDRT
UseCRISPR and Synthetic BiologyAvailable SinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
NYESO beta into TRBC1 HDRT Source (pTR 277)
Plasmid#112024PurposeDNA sequence source for amplifying an HDR template to replace endogenous human TCR-beta with 1G4 NYESO TCR-betaDepositorInsertNYESO beta into TRBC1 HDRT
UseCRISPR and Synthetic BiologyAvailable SinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-IFIT5_K206R-VA
Plasmid#191224PurposeLentiviral expression of human IFIT5_K206R in mammalian cellsDepositorInsertinterferon-induced protein with tetratricopeptide repeats 5 (IFIT5 Human)
UseLentiviralTags3xFlag-TEVx2-6xHis-Strep x2 tag and VA tagExpressionMammalianMutationchanged Lysine 206 to Arginine (K206R)PromoterCMVAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT646 human L1 ORF2p-3xFlag (ORFeus-Hs, CMV promoter) in pCEP4 Puro
Plasmid#213026PurposeExpresses full length human LINE-1 in human cells (codon optimized ORFeus-Hs), with a C-terminal 3xFlag tag on ORF2DepositorInsertHuman LINE-1 (ORFeus-Hs codon optimized sequence) with ORF2-3xFlag
Tags3xFlag (ORF2p)ExpressionMammalianPromoterCMVAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLD564 human L1 ORF2p-3xFlag (L1RP, CMV promoter) in pCEP4 Puro
Plasmid#213030PurposeExpresses full length human LINE-1 in human cells (native L1RP sequence), with a C-terminal 3xFlag tag on ORF2DepositorInsertHuman LINE-1 (L1RP Sequence) with 5' UTR and ORF2-3xFlag
Tags3xFlag (ORF2p)ExpressionMammalianPromoterCMVAvailable SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRT006.3 L1 dual-luciferase AI retrotransposition reporter
Plasmid#213031PurposeBi-directional luciferase antisense intron (firefly fluc AI) human LINE-1 retrotransposition reporter (ORFeus-Hs sequence) for sleeping beauty integrationDepositorInsertTet-On Human LINE-1 (ORFeus-Hs) Firefly + Renilla Luciferase Antisense Intron dual retrotransposition marker
UseLuciferaseTagsFirefly luciferase antisense intron (3' UTR)ExpressionMammalianPromoterpTRE bidirectional tet-onAvailable SinceJuly 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
RAB11A-GFP HDRT Source (pTR 143)
Plasmid#112012PurposeDNA sequence source for amplifying an HDR template to tag endogenous human RAB11A gene with GFPDepositorInsertRAB11A-GFP HDRT (RAB11A Human)
UseCRISPR and Synthetic BiologyAvailable SinceAug. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMT692 ORF2p-3C-3xF (1-1275, ORFeus-Hs) in pDARMO-PolH2.1
Plasmid#213025PurposeExpresses full length human LINE-1 ORF2p Core (1-1275) with a C-terminal 3xFlag tag for baculovirus production in insect cellsDepositorInsertLINE-1 ORF2p (1-1275)
Tags3C-3xFlag (ORF2p)ExpressionInsectPromoterPolyhedrinAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RAB11A-mCherry HDRT Source (pTR 144)
Plasmid#112013PurposeDNA sequence source for amplifying an HDR template to tag endogenous human RAB11A gene with mCherryDepositorInsertRAB11A-mCherry HDRT (RAB11A Human)
UseCRISPR and Synthetic BiologyAvailable SinceJuly 31, 2018AvailabilityAcademic Institutions and Nonprofits only