We narrowed to 13,278 results for: ache
-
Plasmid#45269DepositorAvailable SinceMay 22, 2013AvailabilityAcademic Institutions and Nonprofits only
-
MP6.6TAG_AraC_Para-dnaQ926-dam-seqA-emrR-ugi-CDA1.6TAG
Plasmid#163719PurposeArabinose-inducible expression of six mutagenesis genes, each encoding one amber codon after the initiator methionineDepositorInsertaraC dnaQ926.1TAG dam.1TAG seqA.1TAG emrR.1TAG ugi.1TAG CDA1.1TAG
ExpressionBacterialMutationdnaQ926.1TAG dam.1TAG seqA.1TAG emrR.1TAG ugi.1TA…Available SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
CIBN-rTetR
Plasmid#183919PurposeOptogenetic CIBN localizer domain coupled to reverse Tet repressor; binds tetO sites upon doxycycline addition; CIBN is bound by PHR upon blue light exposureDepositorAvailable SinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
p-mCherry-C1-Aurora
Plasmid#98167Purposered-shifted artificial anion conducting channelrhodopsin (aACR). Activation up to 600 nm; off-kinetics 260 ms. Codon optimized for mammalian expression.DepositorInsertSynthetic construct Aurora gene
TagsmCherryExpressionMammalianMutationV59S, E83N, E90Q, E101S, V117R, E123S, P242R, A24…PromoterCMV (+enhancer)Available SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2 mCherry-Rtn4HD
Plasmid#86685PurposeLentivirus to stably express fluorescent human protein in mammalian cellsDepositorInsertRtn4 homology domain (RTN4 Human)
UseLentiviralTagsmCherryExpressionMammalianMutationhomology domain onlyPromoterCMVAvailable SinceFeb. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV_NOPLight-ctr
Plasmid#195579PurposeExpresses the control sensor NOPLight-ctr in mammalian cellsDepositorInsertNOPLight-ctr
ExpressionMammalianMutationD110A, D130APromoterCMVAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENT-L1-Kozak-Ensconsin-3XGFP-stop-L2
Plasmid#186361PurposeEntry clone with ORF encoding the MT-binding domain of Ensconsin fused to 3 copies of GFP in C-terminal, flanked by Gateway recombination sequences.DepositorInsertHuman Ensconsin (MAP7 Human, Synthetic)
UseExpression of a fluorescent microtubule markerTags3xEGFPAvailable SinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS106a
Plasmid#87382PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pENTR1A hu_ncOGT WT (open N-term)
Plasmid#155197PurposeEntry vector encoding non-tagged O-GlcNAc Transferase with open N-terminusDepositorInsertO-GlcNAc Transferase (OGT Human)
UseGateway cloningMutationWT OGT with no start codon, in-frame with gateway…Available SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-2xLyn-ERex-Venus(Y145W)-bPAC(F198Y)
Plasmid#165493PurposeNeuronal expression of PACmn with dark Venus, a photoactivatable adenylyl cyclase derived from bPAC, membrane-anchored, no/reduced dark activityDepositorInsert2xLyn-ERex-Venus(Y145W)-bPAC(F198Y)
UseAAVTagsdarkVenusExpressionMammalianPromoterCaMKIIAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.SF-iGluSnFR.S72A
Plasmid#106194PurposeWeak affinity glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorInsertSF-iGluSnFR.S72A
UseAAVMutationGltI: S72APromoterGFAPAvailable SinceJuly 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
HA-USPL1-C236A-pcDNA3.1
Plasmid#85764Purposemammalian expression of full length HA tagged USPL1, catalytic inactive variant C236ADepositorInsertUSPL1, full length, catalytic inactive variant variant C236A (USPL1 Human)
TagsHAExpressionMammalianMutationcatalytic inactive mutant C236APromoterCMVAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
HA-USPL1-C236S-pcDNA3.1
Plasmid#85763Purposemammalian expression of full length HA tagged USPL1, catalytic inactive variant C236SDepositorInsertUSPL1, full length, catalytic inactive variant variant C236S (USPL1 Human)
TagsHAExpressionMammalianMutationcatalytic inactive mutant C236SPromoterCMVAvailable SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL-ccdB-mRuby3
Plasmid#166139PurposeGateway destination vector for generation of Galactose-inductibe, C-terminal mRuby3-tagged proteins in yeast. Contains a CEN/ARS element for low copy number when in yeast.DepositorTypeEmpty backboneTagsmRuby3ExpressionYeastAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2 GFP-Rtn4HD
Plasmid#86686PurposeLentivirus to stably express fluorescent human protein in mammalian cellsDepositorInsertRtn4 homology domain (RTN4 Human)
UseLentiviralTagsGFPExpressionMammalianMutationhomology domain onlyPromoterCMVAvailable SinceFeb. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pNL-CEF-IgA1
Plasmid#187009PurposeExpression of human anti-SARS-CoV-2 S Protein Wuhan-Hu1 IgA1DepositorInsertHuman anti-SARS-CoV-2 S Protein Wuhan-Hu1 IgA1
UseLentiviralAvailable SinceJuly 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
sgAAVS1(A)
Plasmid#85570PurposeExpresses sgRNA targeting human AAVS1 locusDepositorInsertadeno-associated virus integration site 1 (AAVS1 Human)
ExpressionMammalianAvailable SinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDEST27-GST-hMSN
Plasmid#211823PurposeExpress human MSN in mammalian cellsDepositorAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hSynapsin1_NOPLight1
Plasmid#195580PurposeExpresses NOPLight1 in neuronsDepositorInsertNOPLight1
UseAAVExpressionMammalianPromoterhuman Synapsin-1Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
shTCF7L2 # 2
Plasmid#42558DepositorAvailable SinceFeb. 14, 2013AvailabilityAcademic Institutions and Nonprofits only