We narrowed to 15,086 results for: nts
-
Plasmid#138560PurposeExpresses human codon-optimized SpCas9-VQR and blasticidin resistance: EFS promoter-VQR-NLS-FLAG-P2A-BSDDepositorInsertVQR
UseCRISPR and LentiviralTagsBSD, FLAG, and NLSExpressionMammalianMutationD1135V, R1335Q, T1337RPromoterEFSAvailable SinceJune 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOPO685
Plasmid#195300PurposepBAD322-MycaIDCas-PaqCI, arapBAD promoter expressing type I-D Cascade and one spacer array of McCAST (Tn7575), the single spacer is replaced with PaqCI entry site.DepositorInsertMcCAST Cascade and native array with PaqCI entry site
ExpressionBacterialPromoterArabinose inducible arapBADAvailable SinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-MYC-ITFG2
Plasmid#87046Purposemammalian expression of ITFG2DepositorAvailable SinceMarch 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pco-vCASphi_E9t_V2_CmYLCVp_35sT_ribozyme_AtPDS3_gRNA10
Plasmid#197966PurposeT-DNA binary vector to express pco-vCasphi driven by UBQ10 gene promoter, and the AtPDS3 guide RNA 10 driven by CmYLCVp, flanked by ribozymes.DepositorInsertspco-vCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoterCmYLCVp and pUBQ10Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJG367
Plasmid#91185PurposeBeYDV replicon T-DNA for gene targeting in tobacco leaves, H840A double nickase (nAtCas9_H840A+gNt_R2+gNt_F2+donor)DepositorInsertnAtCas9_H840A+gNt_R2+gNt_F2+donor
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJG382
Plasmid#91189PurposeBeYDV replicon T-DNA for gene targeting in tobacco leaves, D10A double nickase (nAtCas9_D10A+gNt_R2+gNt_F2+donor)DepositorInsertnAtCas9_D10A+gNt_R2+gNt_F2+donor
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T2 SHP2 E76A
Plasmid#8324DepositorAvailable SinceJune 17, 2005AvailabilityAcademic Institutions and Nonprofits only -
pAT9751-BEAR-mCherry-preedited
Plasmid#162993PurposeBEAR control plasmid with split mCherry and intact 5' splice siteDepositorInsertmCherry split with an intron between amino acids 119-120
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceSept. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pWZL Blast H-Ras G12V T35S
Plasmid#12278DepositorInsertH-Ras G12V T35S (HRAS Human)
UseRetroviralExpressionMammalianMutationContains G12V activating mutation. The T35S mutat…Available SinceJuly 20, 2006AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hMYOD1 gRNA_multi1-3-MS2-Puro
Plasmid#192683PurposeLentiviral expression of multi gNAs targeting hMYOD1 promoter to activate human MYOD1 transcriptionDepositorInsertHuman MYOD1 activating gRNAs #1,2,3 (MYOD1 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFAB3689
Plasmid#47834PurposeBIOFAB RFP reporter plasmid for measuring promoter 3 + BCD1 efficiency.DepositorInsertpromoter 3 and BCD1
UseSynthetic BiologyExpressionBacterialPromotersee insertAvailable SinceDec. 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_21B
Plasmid#91129PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: 35S:AtCas9_dead + AtU6:gRNA, Plant Selection: 2x35S:hpt IIDepositorInsertEngineering Reagent: 35S:AtCas9_dead + AtU6:gRNA
UseCRISPRExpressionPlantMutationD10A, H840AAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf37
Plasmid#12725PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf37
ExpressionMammalianAvailable SinceDec. 1, 2006AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf48
Plasmid#12736PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf48
ExpressionMammalianAvailable SinceDec. 1, 2006AvailabilityAcademic Institutions and Nonprofits only -
CoV2-N-M234I
Plasmid#177955PurposeTransient mammalian expression of codon optimized SARS-CoV-2 Nucleocapsid (M234I). Used for generating RNA packaging virus-like particles.DepositorAvailable SinceNov. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetO-GFP-mSox2
Plasmid#206374PurposeExpresses EGFP fused mouse SOX2 in mammalian cells, for lentivirus generation.DepositorAvailable SinceOct. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
tdp43-EGFP construct10
Plasmid#28203DepositorAvailable SinceSept. 8, 2011AvailabilityAcademic Institutions and Nonprofits only -
BtGRK2-sYFP2
Plasmid#137778PurposeVisualization of GRK2DepositorAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDisplay-GRAB_OTmut
Plasmid#185385PurposeExpresses the genetically-encoded fluorescent oxytocin(OT) control sensor GRAB_OTmut in mammalian cellsDepositorInsertGPCR activation based oxytocin control sensor GRAB_OTmut
ExpressionMammalianPromoterCMVAvailable SinceJune 29, 2022AvailabilityAcademic Institutions and Nonprofits only