We narrowed to 1,758 results for: pyogenes Cas9
-
Plasmid#48140PurposeCas9n (D10A nickase mutant) from S. pyogenes with 2A-EGFP, and cloning backbone for sgRNADepositorInserthSpCas9n
UseCRISPRTags3XFLAG and GFPExpressionMammalianMutationCas9 D10A nickase mutantPromoterCbhAvailable SinceOct. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pX330_SpCas9_USP7 Exon 3 gRNA
Plasmid#131257PurposepX330-U6-Chimeric_BB-Cbh-hSpCas9 vector expressing a guide RNA targeting exon 3 of USP7DepositorInserthumanised S. pyogenes Cas9 nuclease
ExpressionMammalianAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Cas9-NRTH
Plasmid#136925PurposeExpresses Cas9-NRTH in mammalian cellsDepositorInsertCas9-NRTH
UseCRISPRExpressionMammalianMutationsee manuscriptPromoterCMVAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Cas9-NRCH
Plasmid#136926PurposeExpresses Cas9-NRCH in mammalian cellsDepositorInsertCas9-NRCH
UseCRISPRExpressionMammalianMutationsee manuscriptPromoterCMVAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Cas9-NRRH
Plasmid#136924PurposeExpresses Cas9-NRRH in mammalian cellsDepositorInsertCas9-NRRH
UseCRISPRExpressionMammalianMutationsee manuscriptPromoterCMVAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
Native promoter dCas9
Plasmid#113656PurposedCas9 expression unit plasmid. The dCas9 expression unit plasmids contain connector ConL1, ConRE, and one dCas9 transcriptional unit.DepositorInsertNative promoter and dCas9
UseCRISPRExpressionBacterialPromoterS. pyogenes Cas9 native promoterAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCas9(D10A)
Plasmid#74495PurposeNicking Cas9 derived from pWT Cas9 (Addgene #44250). Ampicillin resistance marker, the tetracycline repressor (TetR), a ColE1 origin of replication and Streptococcus pyogenes Cas9 D10ADepositorInsertCas9 D10A
UseSynthetic BiologyExpressionBacterialMutationD10APromoterpTetoAvailable SinceMay 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas9_sgRNA_0
Plasmid#70763Purposeexpresses Ustilago maydis codon-optimized Cas9, contains U. maydis U6 promoter, is self-replicatingDepositorInsertsU6 promoter
cas9
tnos terminator
UseSelf-replicating in ustilago maydis, conferring c…TagsN-terminal NLS, C-terminal HA-tag +NLSMutationStreptococcus pyogenes gene codon-optimized for U…PromoterU6 from Ustilago maydis and synthetic otef promot…Available SinceNov. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
Cas9-sgRNA-A+B
Plasmid#149370PurposeExpresses SpCas9 and two sgRNA targeting the lenti-CDDR reporter at two distal sitesDepositorInsertsCas9
sgRNA-A
sgRNA-B
Puromycin resistance
UseCRISPRTags3xFLAG, Nucleoplasmin NLS, and SV40 NLSExpressionMammalianPromoterCBh, PGK, and U6Available SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-Chimeric_BB-CBh-hSpCas9
Plasmid#42230PurposeA human codon-optimized SpCas9 and chimeric guide RNA expression plasmid.DepositorArticleHas ServiceCloning Grade DNAInserthumanized S. pyogenes Cas9
UseCRISPRTags3xFLAGExpressionMammalianPromoterCBhAvailable SinceFeb. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro (PX459) V2.0
Plasmid#62988PurposeCas9 from S. pyogenes with 2A-Puro, and cloning backbone for sgRNA (V2.0)DepositorHas ServiceCloning Grade DNAInserthSpCas9-2A-Puro V2.0
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterCbhAvailable SinceMarch 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-Puro (PX462) V2.0
Plasmid#62987PurposeCas9n (D10A nickase mutant) from S. pyogenes with 2A-Puro, and cloning backbone for sgRNA (V2.0)DepositorInserthSpCas9n-2A-Puro
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianMutationCas9 D10A nickase mutantAvailable SinceMarch 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
MO91-dCas9-AID(P182X)
Plasmid#83260PurposeExpresses fusion of human codon-optimized S. pyogenes dCas9 (D10A, H840A ) protein with a human AID mutant protein (p182X). MSCV Retroviral backbone.DepositorInsertdCas9-AID P182X
UseRetroviralTags3xFLAG-NLS and FLAGExpressionMammalianMutationD10A and H840A in Cas9; P182X in AIDPromoterMSCVAvailable SinceMay 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCas9-EcRT-GAL-Hyg
Plasmid#232091PurposeYeast CEN plasmid for galactose-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertSpCas9 and Ec86 reverse transcriptase
UseCRISPRExpressionYeastMutationEc86 reverse transcriptase is codon optimized for…PromoterGAL1-GAL10Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas9-EcRT-GAL-HIS3
Plasmid#232093PurposeYeast CEN plasmid for galactose-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertSpCas9 and Ec86 reverse transcriptase
UseCRISPRExpressionYeastMutationEc86 reverse transcriptase is codon optimized for…PromoterGAL1-GAL10Available SinceFeb. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas9-EcRT-GAL-Nat
Plasmid#232090PurposeYeast CEN plasmid for galactose-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertSpCas9 and Ec86 reverse transcriptase
UseCRISPRExpressionYeastMutationEc86 reverse transcriptase is codon optimized for…PromoterGAL1-GAL10Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas9-EcRT-GAL-Kan
Plasmid#232092PurposeYeast CEN plasmid for galactose-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertSpCas9 and Ec86 reverse transcriptase
UseCRISPRExpressionYeastMutationEc86 reverse transcriptase is codon optimized for…PromoterGAL1-GAL10Available SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only